ID: 1032532936

View in Genome Browser
Species Human (GRCh38)
Location 7:132636897-132636919
Sequence CATGCAAAGGATGCAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032532927_1032532936 29 Left 1032532927 7:132636845-132636867 CCAACCCTCGCCTTCGCTATTTG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG No data
1032532929_1032532936 24 Left 1032532929 7:132636850-132636872 CCTCGCCTTCGCTATTTGAATGA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG No data
1032532931_1032532936 19 Left 1032532931 7:132636855-132636877 CCTTCGCTATTTGAATGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG No data
1032532932_1032532936 -10 Left 1032532932 7:132636884-132636906 CCACAGCTAGCTGCATGCAAAGG 0: 1
1: 0
2: 2
3: 17
4: 169
Right 1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG No data
1032532928_1032532936 25 Left 1032532928 7:132636849-132636871 CCCTCGCCTTCGCTATTTGAATG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032532936 Original CRISPR CATGCAAAGGATGCAGGAGG TGG Intronic
No off target data available for this crispr