ID: 1032534426

View in Genome Browser
Species Human (GRCh38)
Location 7:132650063-132650085
Sequence GAGCAGCTGGACCCAGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032534426_1032534431 29 Left 1032534426 7:132650063-132650085 CCAACACCTGGGTCCAGCTGCTC 0: 1
1: 0
2: 0
3: 30
4: 304
Right 1032534431 7:132650115-132650137 TTGAACAGCAGATCTTGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 57
1032534426_1032534429 0 Left 1032534426 7:132650063-132650085 CCAACACCTGGGTCCAGCTGCTC 0: 1
1: 0
2: 0
3: 30
4: 304
Right 1032534429 7:132650086-132650108 TATTGAGCTGCCTTTGTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032534426 Original CRISPR GAGCAGCTGGACCCAGGTGT TGG (reversed) Intronic
900120258 1:1045808-1045830 GGGTGGCTGGACCCAAGTGTGGG + Exonic
900246276 1:1637565-1637587 CAGCAGCTGCACCCGGGTGCAGG - Intronic
900288727 1:1914794-1914816 GAGGAGCTGGACCCTGGCTTTGG + Intergenic
900326120 1:2109534-2109556 GAGCAGATGCAGCCAGGTGTGGG + Intronic
900497097 1:2980711-2980733 GGGCAGCTGGGCCCATGTGGTGG + Intergenic
900519983 1:3100790-3100812 GCACAGCTGGATCCAGCTGTGGG + Intronic
900660361 1:3779003-3779025 GAGCAGCAGGAATCAGGTTTTGG + Exonic
901063641 1:6485143-6485165 GGGCAGCTGCACCCTGGTGACGG - Intronic
901343677 1:8519010-8519032 GAACATCTAGACTCAGGTGTGGG - Intronic
901628762 1:10638359-10638381 GAGCAGCCGGGCCCTGGGGTGGG + Exonic
901850338 1:12011037-12011059 AAGCAGCTGTCCCCAGGTGGGGG - Intronic
903745621 1:25584760-25584782 GAGCATCTGGCCCTATGTGTTGG + Intergenic
904652376 1:32014764-32014786 GAGCGCCTCGACCGAGGTGTAGG + Intronic
904848298 1:33437451-33437473 GAGCAGCTCGTCCCAGATTTAGG - Intergenic
906641978 1:47446360-47446382 CAGCAGATGGACCAAGGTGAGGG - Intergenic
906696659 1:47827904-47827926 GAGTAGCTGTCCCCAGGTGGTGG - Intronic
906947206 1:50305165-50305187 CATCTGCTGGACCCAGGTGATGG + Intergenic
907383542 1:54110744-54110766 GAGAGGCTGGAGCCAGGGGTAGG - Intronic
909936529 1:81557230-81557252 GAGCCGCTGGCACCAGGTGCTGG - Intronic
910616552 1:89205030-89205052 GAGCAGCTGGACCCTGGACCTGG - Intergenic
910803045 1:91164425-91164447 GAGCTGCAGGACCCAGGTGAAGG + Intergenic
911461321 1:98194632-98194654 GAGCATCTGGACACAGATGTAGG + Intergenic
912486818 1:110035230-110035252 GAGCGGCAGGACCCAGGAGCTGG - Intronic
916171073 1:162002166-162002188 AAGCAGCTGGACCCACCTGTGGG - Intronic
918148135 1:181775919-181775941 GAGCAGCTGGATCCAAGTGCCGG - Intronic
919112854 1:193241892-193241914 CAGCAGCAGGACCCAAGTGCTGG - Intronic
921326403 1:213989273-213989295 GAGCTCCTGGACCCAGGGCTGGG + Intronic
923146626 1:231202994-231203016 GAGCAGCAGGGCCCAGGGGATGG + Intronic
1064028482 10:11868360-11868382 GATCATCTGAACCCAGGAGTTGG - Intronic
1064190540 10:13201931-13201953 GAGCAGATTGAGCCAGGAGTAGG - Intronic
1065433900 10:25686871-25686893 GAGCATCTGGACCCTTGAGTGGG - Intergenic
1066241946 10:33546183-33546205 CAGCAGCAGGAACCAGGAGTTGG + Intergenic
1069686070 10:70319572-70319594 TAGCACCTGGTCACAGGTGTAGG - Intronic
1071809682 10:89165837-89165859 GAGTTGTTGAACCCAGGTGTGGG - Intergenic
1073207068 10:101775114-101775136 GAGAAGCTGGACCCACCTGTTGG + Exonic
1075105641 10:119538458-119538480 GAGCAGGGGGACCCAGGCTTTGG + Intronic
1075687383 10:124373740-124373762 GCCCAGCTGGACCCAGGAGCTGG - Intergenic
1075972162 10:126664065-126664087 TTGCAGCTGGCCCCAGGAGTAGG + Intronic
1076776007 10:132698709-132698731 TGGCAGCTGGACGCAGGTTTGGG + Intronic
1077378804 11:2218280-2218302 GGGAAGCTGAGCCCAGGTGTGGG + Intergenic
1077438858 11:2558954-2558976 AGGCAGCTGGCCCCATGTGTGGG - Intronic
1079324667 11:19481260-19481282 GAGCACCTGGCCCCAGGCCTGGG + Intronic
1080822304 11:35819123-35819145 GAGAAGATGGAGGCAGGTGTGGG + Intergenic
1081775781 11:45675143-45675165 GAGCAGCCGGTCCCAGGCATTGG - Intergenic
1082799912 11:57406796-57406818 TGGCAGCTGGACCCAGAGGTGGG - Intronic
1083255430 11:61492537-61492559 CAGCAGCAGGAGCCAGGGGTGGG - Intergenic
1083813607 11:65119251-65119273 GATCACCTGGGCCCAGGAGTTGG + Intergenic
1083892827 11:65605381-65605403 GGGAAGCTGGACCCAGATGGGGG - Intronic
1084432257 11:69117620-69117642 GAGCGGCTGGACATAGGTGGTGG + Intergenic
1084682979 11:70677871-70677893 GAGCTGCTTGTCCCAGTTGTAGG + Intronic
1085295893 11:75431450-75431472 GGGCCGCTGGACCCAGGTGGAGG + Intergenic
1085302669 11:75467577-75467599 GAGCAGCTGGCTCCTGGGGTAGG + Intronic
1085514808 11:77105923-77105945 GAGGGGCTGGAAGCAGGTGTGGG + Intronic
1085638675 11:78177534-78177556 CAGGAGGTGGACCCAGGAGTGGG + Intronic
1086054140 11:82627737-82627759 GAGCAGCTGGAAAGGGGTGTTGG - Intergenic
1087386897 11:97483136-97483158 GGGCAGGTGCACCCTGGTGTGGG - Intergenic
1089602333 11:119623664-119623686 GGGCAGCTGGCCCCAGGTCGTGG + Intronic
1090660970 11:128881170-128881192 GATCAGCTGGAGGCAGGTGGGGG + Intergenic
1090667046 11:128921334-128921356 GGGCAGCTGCAACCAGGTGTTGG + Intergenic
1091391918 12:131025-131047 GAGGAGCGGGGGCCAGGTGTGGG - Intronic
1094842819 12:34349122-34349144 AAGCAGCTGGACCCCGCTGGGGG - Intergenic
1095943469 12:47740668-47740690 GAGCAGCTGGGCCCGGGGGCCGG + Exonic
1096989982 12:55792904-55792926 GATCAGTTGAACCCAGGAGTTGG - Intronic
1099478794 12:83140896-83140918 CAGCAGCTACAACCAGGTGTGGG + Intergenic
1100396922 12:94193783-94193805 GACCAGATGGACAGAGGTGTCGG + Intronic
1100529411 12:95450145-95450167 GAGCGGCTGGAAAGAGGTGTTGG + Intergenic
1101406425 12:104433097-104433119 GAGCTGCTGGCCACAGTTGTGGG - Intergenic
1101861649 12:108487051-108487073 GAACAGCTGGACACAGGAGGGGG - Intergenic
1101870350 12:108560826-108560848 GAGCAGGTGGGCCCGGGGGTGGG - Exonic
1102270236 12:111527680-111527702 GAGCAGCAGGACTCAGCTGGGGG + Intronic
1102651774 12:114447522-114447544 GCGCAGCTGGACCGGGGTGAGGG + Intergenic
1102930020 12:116855149-116855171 AGGCAGCTGGACCCATGTGGTGG + Intergenic
1103004247 12:117408746-117408768 GGACAGCTGGGCCCAGGTGACGG - Intronic
1103938177 12:124487446-124487468 GAGGAGCTTGACTCAGGTGTGGG - Intronic
1104468162 12:129006704-129006726 GAGCACCTGAACCCGGGTGGGGG + Intergenic
1104768085 12:131343499-131343521 GAGCAGCTGGAAAGGGGTGTTGG + Intergenic
1106754794 13:32811742-32811764 GAGCAGCAGGTCCCAGGAATGGG - Intergenic
1109193660 13:59354556-59354578 GAGAAACTGAACCCAGGTGAGGG - Intergenic
1110405803 13:75149212-75149234 GAGCATCTGGGCCCAAGTGCAGG - Intergenic
1119472268 14:74907474-74907496 GGGCAGCTGGAGCTGGGTGTGGG + Exonic
1121767159 14:96497806-96497828 CAGCAGCTGGAGGGAGGTGTGGG + Intergenic
1122402691 14:101476612-101476634 GAGCACCTGGGCATAGGTGTGGG + Intergenic
1122834419 14:104423947-104423969 GAGCCGCTGGGCCCAGCTGGAGG - Intergenic
1122921500 14:104882294-104882316 AGGTGGCTGGACCCAGGTGTGGG + Intronic
1123696330 15:22881552-22881574 GGGCAGCAGGACCCAGCAGTCGG + Intronic
1123877770 15:24641008-24641030 GAGCAGCTGGACCCTTTTGCTGG + Intergenic
1124410855 15:29435358-29435380 AAGCAGCTGGACCCACATTTTGG + Intronic
1125655050 15:41349376-41349398 GAGCAGCTGGACTTGGGTCTGGG - Intronic
1126760462 15:51965328-51965350 GAGCAGCTGTACTGAGATGTGGG - Intronic
1129120752 15:73394971-73394993 GAGCAGCTGGCCCCAGTTCTGGG - Intergenic
1129327674 15:74809719-74809741 GAGCAGATGGAGGCAGGTGAGGG + Intergenic
1132043055 15:98541270-98541292 GATCACCTGGGCCCAGGAGTCGG + Intergenic
1135227223 16:20671487-20671509 TAGAGGCTGGACCCAGATGTGGG - Intronic
1135409347 16:22221385-22221407 GATCACCTGAACCCAGCTGTTGG + Intronic
1136021641 16:27444379-27444401 GAGTAGCTGGACTCAGGCATGGG - Intronic
1136998342 16:35207233-35207255 GAGAGGCCCGACCCAGGTGTGGG + Intergenic
1137029057 16:35505835-35505857 GAGAGGCCCGACCCAGGTGTGGG + Intergenic
1137589288 16:49683696-49683718 GAGGAGCTGGTGCTAGGTGTGGG - Intronic
1137613888 16:49835803-49835825 GAGCTGCTGCTCCCGGGTGTTGG + Intronic
1138413812 16:56859768-56859790 GAGCAGAGGGACCAAGGAGTTGG - Intergenic
1138579861 16:57933598-57933620 TAGCAGCTGGGCACAGGTGTGGG + Intronic
1139371859 16:66473913-66473935 GAGGACCAGGACCAAGGTGTGGG - Intronic
1139896302 16:70290179-70290201 GATCACCTGAACCCAGGAGTTGG + Intronic
1141947436 16:87320274-87320296 GAGTTGCTTGACCCATGTGTGGG + Intronic
1141994912 16:87630232-87630254 CAGCAGCTGGCCCCAGAGGTGGG - Intronic
1142012714 16:87724798-87724820 GAGCTGCTGGGCCCTGGGGTGGG - Intronic
1142223582 16:88866698-88866720 GAGCAGCTGGCCTCAGGGGAGGG - Intergenic
1142265392 16:89062027-89062049 GAGCAGCAGGGCCCCTGTGTGGG - Intergenic
1142500036 17:327181-327203 AGTCAGCTGGACCCAGGTGTGGG + Intronic
1143063317 17:4222079-4222101 GAGCGGCTGGGGCCAGGGGTAGG + Intronic
1143125673 17:4639791-4639813 GAGCAGGTGGCCCCAGGACTCGG + Intronic
1143145560 17:4772840-4772862 GAGCAGCTGGAACCACAGGTGGG + Intronic
1143321490 17:6071461-6071483 GAGCAGCTGGATCCCAGTGCAGG - Intronic
1143402802 17:6657032-6657054 GAGCAGGTGGCCCCAGGACTCGG - Intergenic
1146290660 17:31604646-31604668 GGGCCTCTGGGCCCAGGTGTTGG + Intergenic
1147897488 17:43760161-43760183 GAGCAGCTGCATTCATGTGTCGG - Intergenic
1148091030 17:45022569-45022591 GAGGAGCTGGAGCCTGGGGTTGG - Intergenic
1149494108 17:57106205-57106227 GAGCAGCTCATCCCAGGTGGTGG + Exonic
1150227428 17:63531556-63531578 TTGCTGCTGGAACCAGGTGTGGG + Intronic
1151460197 17:74249793-74249815 GTGCAGCTGCAGCCAGGTGGGGG + Intronic
1152254219 17:79228020-79228042 GGTCAGAAGGACCCAGGTGTGGG + Intronic
1152351950 17:79789246-79789268 GAGAAGCTGGGCCTAGATGTTGG + Intergenic
1152756333 17:82088593-82088615 GAGCCCCTGGACCCCGGTGACGG - Intronic
1152821551 17:82440128-82440150 GAGCAGCGGGACCCATGGGCAGG + Intronic
1157396503 18:47346036-47346058 GAGCAGCAGGGCCCAGCAGTCGG - Intergenic
1158386657 18:57000974-57000996 GATCAGTTGGGCCCAGGAGTTGG + Intronic
1158708525 18:59816665-59816687 GATCAACTGGACCCAGGGGTTGG + Intergenic
1158809764 18:61018786-61018808 GAGCAGCTGGAAACTGCTGTGGG - Intergenic
1159957855 18:74532619-74532641 GTGAGGCTGGGCCCAGGTGTGGG - Intergenic
1160615616 18:80125161-80125183 GAGTATCTGGACCCAGGGGTTGG + Intronic
1160789407 19:916761-916783 TAGCAGCGGGAACCAGGTGGAGG - Intergenic
1162446439 19:10725838-10725860 GACCACCTGAACCCAGGAGTTGG - Intronic
1162739741 19:12767153-12767175 CAGGAACTGGAGCCAGGTGTTGG + Intronic
1162958561 19:14113192-14113214 GAGCGGCTAAACCCAGGGGTGGG + Intronic
1164423452 19:28118416-28118438 GAGCAGCTGGACCCCTTTGCCGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165863545 19:38922056-38922078 GTGCGGCTGGATCCAGGTGCTGG - Exonic
1166054254 19:40279237-40279259 GAGCACCTGGGCCCTGCTGTGGG + Intronic
1166565307 19:43761472-43761494 CAGCAGCTGGAGGCAGATGTGGG + Intergenic
1167048039 19:47062808-47062830 GAGCACCTGGCACCAGTTGTTGG + Intergenic
1167625569 19:50586151-50586173 GAGCAGCTGAACCCGGGAGGCGG + Intergenic
925386921 2:3468355-3468377 GAGCAGCTGGACCAGGGTCGGGG - Intronic
925437315 2:3850904-3850926 CAGCAGCTGGACCAAGATATGGG + Intergenic
926789367 2:16554806-16554828 TAGGACCTGAACCCAGGTGTGGG - Intronic
927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG + Intronic
928163877 2:28955287-28955309 GAGCAGATGGAGAAAGGTGTGGG - Intergenic
931233125 2:60390938-60390960 GAACAGCTGGATCCAGGGGTTGG - Intergenic
931420216 2:62120283-62120305 GAGCCACTGCACCCAGCTGTGGG + Intronic
932790905 2:74654107-74654129 GCGGAGCTAGACCCAGGTGAAGG - Intergenic
934777659 2:96949506-96949528 GAGGAGCTGGACCCAGGGATGGG - Intronic
934985254 2:98880695-98880717 GAGCAACTAGATGCAGGTGTGGG - Intronic
937937725 2:127259509-127259531 AAGCAGGTGGACCCAGGAGAAGG - Intronic
938366938 2:130742386-130742408 GAGCAGCTGGACCCAATCGAGGG + Intergenic
941905786 2:170715670-170715692 GTGCAGCTGGAGCCAGGCCTAGG + Intronic
941929321 2:170924639-170924661 CTGCAGCTGCACCCAGGAGTTGG + Intergenic
945796377 2:214369615-214369637 GAGAATCAGGAACCAGGTGTGGG - Intronic
947059834 2:226151337-226151359 GGGCAGCTTGACCCAAGTCTTGG + Intergenic
947483132 2:230521641-230521663 GAGCAGCTGGACCTAGATCAGGG + Intronic
947587262 2:231364216-231364238 GAGCAGCCCCAGCCAGGTGTGGG + Intronic
948047161 2:234952901-234952923 GAGCCGCGGGACCCAGGGTTGGG - Intronic
1170095928 20:12646005-12646027 GAGCAGCTGGTAGCAGGTGATGG - Intergenic
1170595017 20:17798738-17798760 GGGCAGCTGGAGGCAGGGGTGGG - Intergenic
1171517704 20:25750849-25750871 GAGAGGCCTGACCCAGGTGTGGG + Intergenic
1172530344 20:35626643-35626665 GAGCAGCTGGACGCTGATGGTGG - Exonic
1172812220 20:37656736-37656758 GCGCAGCTGGTCCATGGTGTGGG - Intergenic
1173569748 20:44068540-44068562 GGGCAGCTGAATCCAGGGGTGGG + Intronic
1174035837 20:47667800-47667822 GACCAGCTGGAGGCAGGTGGTGG + Intronic
1174334118 20:49845647-49845669 GAGAAGCTGGACCAGGGAGTGGG - Intronic
1174421137 20:50399870-50399892 GAGCAGCAAGCACCAGGTGTGGG - Intergenic
1175301405 20:57945890-57945912 CAGGAGCTGGACCCAGGATTGGG + Intergenic
1175542973 20:59759759-59759781 GAGCGACTGGGCCCAGATGTGGG - Intronic
1175945537 20:62556809-62556831 GAGCAGGTAGCACCAGGTGTAGG + Intronic
1176097949 20:63352888-63352910 GGGCGGCTGGAGCCAGGGGTGGG - Intronic
1176179229 20:63741734-63741756 GAGGAGCTGGCCCCAGGGCTTGG - Intronic
1179270417 21:39846363-39846385 GAGCAGCGGCAGGCAGGTGTTGG + Intergenic
1179518208 21:41924238-41924260 GAAGAGCTGGACCCAGGGCTTGG - Intronic
1180189458 21:46155526-46155548 GAGCATCTGGATCAAGGTGCTGG - Exonic
1181042501 22:20198840-20198862 CAGCAGCTTGGCCCAGCTGTAGG - Intergenic
1181564354 22:23725486-23725508 GAGAAGCTGGACACAGGCATGGG + Intergenic
1182460293 22:30478746-30478768 GAGAAGCAGCAGCCAGGTGTCGG + Intergenic
1183172362 22:36197779-36197801 GAGCTGCTGTAACCAGCTGTAGG + Intronic
1183352611 22:37342561-37342583 CAGCAGTGGGACCCAGGAGTGGG - Intergenic
1183512713 22:38245340-38245362 GAGAAGCGAGACCCAGGTGGAGG + Intronic
1183512770 22:38245584-38245606 GAGAAGCGAGACCCAGGTGGAGG + Intronic
1183512783 22:38245645-38245667 GAGAAGCGAGACCCAGGTGGAGG + Intronic
1183512795 22:38245706-38245728 GAGAAGCGAGACCCAGGTGGAGG + Intronic
1183674995 22:39294224-39294246 GACCAGCTGGGCCCAGGACTGGG + Intergenic
1183898909 22:40990653-40990675 GAGCCGCTGGCACCTGGTGTTGG + Intergenic
1184083748 22:42245303-42245325 GATCACTTGAACCCAGGTGTTGG - Intronic
1184478186 22:44732545-44732567 GAGCAGCTGGTCAGAGCTGTGGG + Intronic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
1185025021 22:48403905-48403927 GAGGAGGGGGACCCAGGTGGGGG - Intergenic
949419247 3:3848313-3848335 GAGCAGATGGAACTAGGTTTAGG + Intronic
949511062 3:4767603-4767625 GATCATCTGGGCCCAGGAGTTGG - Intronic
950204961 3:11072130-11072152 CAGCATCTGGGCCCATGTGTTGG + Intergenic
950358451 3:12431851-12431873 GATCACCTGAACCCAGGAGTTGG + Intronic
950957901 3:17074318-17074340 GAGCAGTAGGTCCCAGCTGTGGG + Intronic
952494368 3:33902934-33902956 TAGCAGCTGTACCCAGGAGAGGG + Intergenic
952795794 3:37238033-37238055 GAACACCTGAGCCCAGGTGTTGG + Intergenic
952821563 3:37490887-37490909 GAGGAGCTGGAACCAGGTTGTGG - Intronic
953055876 3:39386847-39386869 GAGGAGCTGGTCGGAGGTGTGGG + Intronic
954110600 3:48430762-48430784 AAGCACCTGGACTCAGGTGCTGG - Intergenic
954432984 3:50481179-50481201 GGGCAGCTGGACCCAGCAGAGGG + Intronic
954708466 3:52493556-52493578 GGGGAGGTGGACCCAGGTGGTGG + Intergenic
954874116 3:53789925-53789947 GAGCTCCTGGATCCATGTGTGGG + Intronic
955452793 3:59087943-59087965 GAGAAGATGGACCCAACTGTAGG - Intergenic
961454089 3:127015814-127015836 GAGGGTCCGGACCCAGGTGTGGG + Intronic
961768288 3:129229142-129229164 CAGCAGCTGGAGCCATCTGTGGG - Intergenic
963763478 3:149308889-149308911 GTGCAGATGGACCCAGCTGTAGG - Intergenic
966421561 3:179739316-179739338 TAGCAGCTGCAGCCAGGTGAGGG + Intronic
966503432 3:180672261-180672283 GAGCAGCTGGAATCAAGAGTGGG - Intronic
967137698 3:186526455-186526477 CAGCAGCTGGAACCAGATATAGG + Intergenic
968522900 4:1042230-1042252 GAGCAGCAGGACCCTGGACTTGG - Intergenic
969112048 4:4850332-4850354 GGGCAGCTGCACCCGGGTGGTGG - Intergenic
969376965 4:6769301-6769323 CCGCAGCTGCACCCAGGTATGGG - Intergenic
969443082 4:7228726-7228748 GAGCAGCTGGACAGAGTCGTAGG - Intronic
969582470 4:8073183-8073205 GAGCGGCTGGACCCAGGCACAGG + Intronic
971593508 4:28498170-28498192 GGGCAGCTGGACCCTGGGCTTGG + Intergenic
974062844 4:57051303-57051325 TAGCAGCTGAACCCTGGTATGGG + Intronic
975784936 4:77877643-77877665 GTGCAGCTGGACCTTGGGGTTGG + Intronic
977832660 4:101612955-101612977 CAACATCTGGACCCATGTGTTGG + Intronic
979211046 4:118103564-118103586 CAGATGCTGGACCCTGGTGTGGG - Intronic
979523867 4:121697199-121697221 GAGCTGCTGGAACCAGGAGGAGG + Intergenic
980961129 4:139477168-139477190 GAGAAGCTGGACCCAGAGTTAGG - Intergenic
982000188 4:151015238-151015260 GAGCAGCGAGACCGAGGTGGCGG + Intronic
984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG + Intergenic
985661175 5:1157353-1157375 GAGCAGATGGGAACAGGTGTGGG - Intergenic
985661219 5:1157622-1157644 GAGCAGATGGGAACAGGTGTGGG - Intergenic
986123715 5:4866700-4866722 GAGCAGCTGGAGCCCGGCTTTGG - Intergenic
986229982 5:5854386-5854408 TAGCAGATGGAACCAGGTGCAGG + Intergenic
990628048 5:57636334-57636356 GGGCAGAAGGACGCAGGTGTGGG + Intergenic
990977020 5:61569308-61569330 GAGGACCTAGACCCAGCTGTTGG + Intergenic
991575027 5:68093686-68093708 GAACAGGTTGACCCAGCTGTTGG + Intergenic
994041475 5:95264457-95264479 GAGCTGCTGGACTCAGCTGCTGG - Intronic
994206534 5:97042525-97042547 GAGCAGCTGGCCCCAAGGTTTGG + Intergenic
994666125 5:102707673-102707695 GAGCCCCTGGATCCAGGTTTTGG - Intergenic
995707190 5:114998174-114998196 GAGCAGCTGGAAAGGGGTGTTGG - Intergenic
996902324 5:128556570-128556592 GAACAGCTGGACCCAGGAAGGGG + Intronic
997395163 5:133553876-133553898 GAGAACCTGGACTCAGGGGTGGG + Intronic
997589646 5:135064888-135064910 GAGCAGCTGGGCTCAGCTTTGGG + Intronic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
999685695 5:154100955-154100977 AACCAGCTGGTCCCAGGTGTTGG - Intronic
1000878423 5:166668710-166668732 GTGCAGTTGGAGCCAGGTCTGGG - Intergenic
1001535724 5:172496678-172496700 GAGGAGCTGGACGCCAGTGTAGG + Intergenic
1001664441 5:173421050-173421072 GAGCCACTGCACCCAGGTGGGGG + Intergenic
1002163134 5:177328521-177328543 GTGCAGAAGGACCCAGGGGTCGG + Intergenic
1002534146 5:179866955-179866977 GAGCATCTGATCCCAGGTGATGG - Intronic
1003342323 6:5233695-5233717 GATCAGTTGCACCCAGGAGTTGG - Intronic
1003637086 6:7842247-7842269 GTGCAGCTGCAACCAGGTGGTGG + Intronic
1004209697 6:13626765-13626787 GAGCAGCTGAACCTAGGAGATGG - Intronic
1004564370 6:16781735-16781757 GAGAATCAGGACCCAGGCGTAGG - Intergenic
1005493418 6:26368232-26368254 GAGCAGCTGGACCAAGAGGAGGG - Exonic
1005502654 6:26443624-26443646 GAGCAGCTGGACCAAGAAGAGGG - Exonic
1009385200 6:63078943-63078965 GAGCAGCTGGAAAGGGGTGTTGG + Intergenic
1010098884 6:72079660-72079682 GATCAGTTGAACCCAGGAGTTGG + Intronic
1010394872 6:75379580-75379602 CAGCAACAGGACCCAAGTGTTGG + Intronic
1011224863 6:85094909-85094931 GAGCAGCTGGAAAGGGGTGTTGG - Intergenic
1012986168 6:105878445-105878467 GAGAAGCTGGATCCAAGTCTAGG + Intergenic
1013109457 6:107053611-107053633 GAGAATCTGAACCCAGGTGGTGG - Intergenic
1015846895 6:137530390-137530412 GAGCAGCTGGAAACAGGTCATGG + Intergenic
1016666753 6:146651155-146651177 TAGCTGCTGGTCCCAGGTATGGG + Intronic
1017070347 6:150570533-150570555 AAGCAGCTGGGCACAGGGGTTGG - Intergenic
1017802497 6:157910121-157910143 GAGCAGCAGGATGCAGGAGTTGG + Intronic
1018704726 6:166455445-166455467 AGGCAGCTAGAGCCAGGTGTCGG + Intronic
1019024249 6:168943864-168943886 GTGCAGCAGGACCCAGGCCTGGG - Intergenic
1019354771 7:572722-572744 GAGCAGGAGGCCCCAGGTGGAGG + Intronic
1019623115 7:2002228-2002250 GAGCAACGGGACCCAGGAGCTGG + Intronic
1019685496 7:2379746-2379768 GAGGAGCTGTGGCCAGGTGTTGG + Intronic
1019713980 7:2529996-2530018 GTGTGGCTGGACCCAGGGGTCGG + Intergenic
1019734874 7:2645687-2645709 GAGAAGCTGCACTCAGGGGTGGG - Intronic
1023108037 7:36782339-36782361 GAGCAGGCAGACCCAGGAGTGGG - Intergenic
1024093744 7:45968243-45968265 GAGCAGCAGGCACCAGGGGTGGG - Intergenic
1025258832 7:57403868-57403890 GAGAGGCCTGACCCAGGTGTGGG + Intergenic
1025798097 7:64758637-64758659 GAGCAGCTGGAAAGGGGTGTTGG + Intergenic
1026022016 7:66715838-66715860 GAGCACCTGAACCCAGGAGTTGG - Intronic
1026640562 7:72120900-72120922 GAGCATCTGAATCCAGGTGAGGG + Intronic
1028494480 7:91448485-91448507 GAGCAGCTGGAAAGGGGTGTTGG + Intergenic
1029442115 7:100592704-100592726 GGGCAGCTGGATCCTGGGGTGGG - Intronic
1031062179 7:117064511-117064533 CAGCAGCAGGACCAACGTGTTGG + Intronic
1031865105 7:127030164-127030186 CAGGAGCTGGACCAATGTGTAGG - Intronic
1032534426 7:132650063-132650085 GAGCAGCTGGACCCAGGTGTTGG - Intronic
1033717994 7:144022744-144022766 GATGAGCTGGAGCCAGCTGTGGG + Intergenic
1034441721 7:151089029-151089051 GGGCAGCAGGGCCCAGGAGTGGG - Intronic
1035889713 8:3330068-3330090 GAGGAGCTGCACCCAGGGATGGG - Intronic
1036824280 8:11964082-11964104 GAGCTGCTGGAACCAGGAGGAGG - Intergenic
1037275951 8:17179076-17179098 GAGTAGCTGGAACCATGGGTGGG + Intronic
1038227666 8:25671641-25671663 GGGCAGCTGGAGCGAGGTCTTGG + Intergenic
1038500014 8:28035967-28035989 GATCACCTGAGCCCAGGTGTTGG - Intronic
1038783936 8:30593577-30593599 GATCACCTGAACCCAGGAGTTGG - Intronic
1039984962 8:42439369-42439391 GACCAGCTGGGCCTGGGTGTGGG - Intronic
1040650170 8:49439236-49439258 CAGCATCTGGGCCCATGTGTTGG - Intergenic
1040682780 8:49833789-49833811 CAGCATCTGGGCCCATGTGTTGG + Intergenic
1041335439 8:56776962-56776984 CAGCAGAATGACCCAGGTGTAGG + Intergenic
1042196910 8:66238608-66238630 GGGCAGCTGCACCCAGGGATTGG + Intergenic
1044004776 8:86927175-86927197 GAGCAGCTGGAAAGGGGTGTTGG + Intronic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1049417871 8:142503786-142503808 GAGCTGCTGGACCCTGGGGAGGG + Intronic
1049687544 8:143944957-143944979 GAGCTGGGGGACCGAGGTGTCGG - Intronic
1049734579 8:144198107-144198129 GAGGAGCTGGCCCCAGGGCTCGG - Intronic
1049820193 8:144628801-144628823 GAGAAGCTGGACCAGGATGTGGG - Intergenic
1051249834 9:15148407-15148429 GATCACTTGGACCCAGGAGTTGG + Intergenic
1052512065 9:29434789-29434811 GATCACCTGAACCCAGGAGTTGG + Intergenic
1053131895 9:35620042-35620064 GAGCAGCTGGTGGCAGGGGTGGG + Intronic
1053507509 9:38655820-38655842 GAGAACCTGCACCCAGGTGGTGG - Intergenic
1055455846 9:76470871-76470893 CAGCAGCTGGATCCAGGAATGGG + Intronic
1055552392 9:77443893-77443915 GATCATTTGAACCCAGGTGTTGG + Intronic
1056843573 9:90018422-90018444 GAGTAGCAGGACGCAGGTCTAGG + Intergenic
1057909262 9:99005238-99005260 GAGCAGCTGGGCCCTGGGGATGG + Intronic
1060249751 9:121976295-121976317 GAGTGGCTGGCCCCAGTTGTAGG - Intronic
1060758614 9:126230163-126230185 GAGCAGCTGGACCAAGATCTTGG - Intergenic
1061295147 9:129672769-129672791 GGGCAGCTGGAGACAGGTGAGGG - Intronic
1061306370 9:129735491-129735513 GAGCTGGAGGACCCAGGTGCGGG - Intergenic
1061390840 9:130316308-130316330 GGGCAGATGGACACAGGGGTAGG + Intronic
1061432916 9:130542741-130542763 GTGCAGCAGGACCCAGGTGAGGG - Intergenic
1061875382 9:133540949-133540971 TAGCAGCTGCACCCACGTGACGG + Exonic
1062127018 9:134869433-134869455 GGGCAGCTGGTCCCAGGAGAGGG - Intergenic
1062133674 9:134913518-134913540 GTGCAGCTGGCCCCAGGGGTGGG + Intronic
1062483844 9:136764558-136764580 GAGCAGGTGCACCCAGGTGGTGG - Intronic
1062618477 9:137408600-137408622 GAGCAGCTGGGGGGAGGTGTGGG - Intronic
1187448955 X:19380372-19380394 GATCACCTGAGCCCAGGTGTTGG + Intronic
1187505599 X:19875862-19875884 CAGCAGCTGGAGCTAGGTGTGGG - Intronic
1188115632 X:26239057-26239079 GAGCAGCAGGACCCTGGTGCTGG + Intergenic
1189169743 X:38897661-38897683 GAGCAGCTAGACCCATGCATAGG + Intergenic
1189252950 X:39615023-39615045 GCGCTGCTGGAACCAGGTGGTGG + Intergenic
1191747498 X:64505694-64505716 GATCAGATGGAGGCAGGTGTAGG - Intergenic
1195577451 X:106467631-106467653 GAGCAGGAGGACCCAGGAGTGGG - Intergenic
1196130489 X:112150098-112150120 GAGCAGCATGAGCCAGGTGGAGG + Intergenic
1198882718 X:141298566-141298588 GAGCTGGTGGCCCCAGGTGTGGG - Intergenic
1199765232 X:150936535-150936557 CACCAGCTGGACCCAGTTGTTGG + Intergenic
1201406871 Y:13658600-13658622 GAGCAGCTGGAAAGGGGTGTTGG + Intergenic
1201430307 Y:13896057-13896079 GAGCAGCTGGAAAGGGGTGTTGG - Intergenic
1201468902 Y:14313306-14313328 GAGCAGCTGGAAAGGGGTGTTGG - Intergenic
1201495914 Y:14591330-14591352 GAGCAGCTGGAAAGGGGTGTTGG + Intronic
1201911694 Y:19139300-19139322 GAGCAGCTGGAAACGGGTGTTGG - Intergenic
1202048838 Y:20760335-20760357 GAGAAGCTGTCCTCAGGTGTTGG + Intronic