ID: 1032537779 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:132678755-132678777 |
| Sequence | AGGTTAGATGCCCCTCTTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 99 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 90} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1032537779_1032537782 | 23 | Left | 1032537779 | 7:132678755-132678777 | CCTTTAAGAGGGGCATCTAACCT | 0: 1 1: 0 2: 0 3: 8 4: 90 |
||
| Right | 1032537782 | 7:132678801-132678823 | TCCTGAAGAAAGTAAAGTTTTGG | No data | ||||
| 1032537779_1032537780 | -7 | Left | 1032537779 | 7:132678755-132678777 | CCTTTAAGAGGGGCATCTAACCT | 0: 1 1: 0 2: 0 3: 8 4: 90 |
||
| Right | 1032537780 | 7:132678771-132678793 | CTAACCTAGTGTTGAGCATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1032537779 | Original CRISPR | AGGTTAGATGCCCCTCTTAA AGG (reversed) | Intronic | ||