ID: 1032537779

View in Genome Browser
Species Human (GRCh38)
Location 7:132678755-132678777
Sequence AGGTTAGATGCCCCTCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032537779_1032537780 -7 Left 1032537779 7:132678755-132678777 CCTTTAAGAGGGGCATCTAACCT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1032537780 7:132678771-132678793 CTAACCTAGTGTTGAGCATCAGG No data
1032537779_1032537782 23 Left 1032537779 7:132678755-132678777 CCTTTAAGAGGGGCATCTAACCT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1032537782 7:132678801-132678823 TCCTGAAGAAAGTAAAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032537779 Original CRISPR AGGTTAGATGCCCCTCTTAA AGG (reversed) Intronic
906108919 1:43310631-43310653 AGAGTAGATGCCCCACTTCATGG - Intronic
909502671 1:76353335-76353357 AGGTTGGAAGCCTCTCTGAAGGG - Intronic
912798323 1:112706083-112706105 GGCTCAGTTGCCCCTCTTAAGGG - Exonic
915996774 1:160571727-160571749 AGGTTAGATGCTCCTGCTCATGG + Intronic
916826561 1:168447545-168447567 AGGTTAAATTCACCTCCTAAAGG - Intergenic
917937005 1:179878139-179878161 GGATTACATGCTCCTCTTAATGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1071545355 10:86524747-86524769 AGGGCAGAGGCCCCTCCTAAGGG - Intergenic
1072787966 10:98296973-98296995 AGGTTTTCTGCCCCTCTTAGGGG + Intergenic
1074174809 10:110987513-110987535 GGTTTAGATGTCCCTCTGAAAGG + Intronic
1074739634 10:116473024-116473046 AGGTTAGATGCCTCTGTGCAGGG - Intronic
1081909350 11:46690697-46690719 AGGTTAGCTGCCCCTTTTCATGG + Intronic
1082636933 11:55607656-55607678 AGTTTACATCCCCATCTTAATGG + Intergenic
1083659005 11:64243496-64243518 AGGTAAGAGGCCCCTCCTGAGGG + Exonic
1084175430 11:67420173-67420195 AGCTTAGAGGCCCCTCCTGAAGG - Intronic
1086896993 11:92324804-92324826 AGATTAGATGCCACTATTCATGG - Intergenic
1090153120 11:124405803-124405825 AAGTTGGATGAGCCTCTTAAAGG + Intergenic
1091010220 11:131994421-131994443 AGGTTAGATATCCCTCCTGAGGG - Intronic
1095118050 12:38380018-38380040 ATGTTAGATGAGTCTCTTAAAGG + Intergenic
1095841319 12:46696737-46696759 AGGTCAGATGAATCTCTTAAAGG + Intergenic
1099203141 12:79698808-79698830 AAGTTATCTGCTCCTCTTAAAGG + Intergenic
1099216856 12:79863488-79863510 GGGCTAAATGCCCCACTTAAAGG + Intronic
1101524964 12:105520220-105520242 AAGATAGATGTCCCTGTTAAAGG + Intergenic
1102137256 12:110585718-110585740 AGGTCAGTTGCCACTCTTAAAGG + Intergenic
1107381287 13:39858976-39858998 AGCATTGTTGCCCCTCTTAAGGG - Intergenic
1110344907 13:74434663-74434685 AGGTGGGATGCCCTTCTGAAGGG + Intergenic
1110689937 13:78421153-78421175 AGTGTAGATGCCTCTCTTGATGG - Intergenic
1113523877 13:110958836-110958858 GGGTTAGAGGCCCAACTTAAGGG + Intergenic
1121428507 14:93870856-93870878 AGATTAGATGCCCTTATAAAAGG + Intergenic
1126544833 15:49862037-49862059 AGTATAGATGCCTCTCTTCATGG + Intronic
1139496220 16:67320483-67320505 TGCTGAGATGACCCTCTTAATGG - Intronic
1146502068 17:33372827-33372849 AGGGTAGATGCCCCTCATCGTGG + Intronic
1146608889 17:34287433-34287455 GGGTTAGTTGCTGCTCTTAAAGG - Intronic
1147839324 17:43359739-43359761 GGGTTAGAGGCCCAACTTAATGG - Intergenic
1149137000 17:53379497-53379519 ATGTGAGATGCATCTCTTAAAGG + Intergenic
1152372075 17:79894927-79894949 AGGTTAGGTGCCCCTCACAAGGG - Intergenic
1153534255 18:6083803-6083825 AGGTCATATGCACCTCTTTATGG - Intronic
1154483169 18:14856200-14856222 AGGTGAGAAGCGCCTCTTCACGG - Intergenic
1154483590 18:14857823-14857845 AGGTGAGAAGCGCCTCTTCACGG - Intergenic
1154484011 18:14859443-14859465 AGGTGAGAAGCGCCTCTTCACGG - Intergenic
1155979022 18:32161764-32161786 AGGTTAGCTGGTCCTCTGAAGGG - Intronic
1157962696 18:52174320-52174342 AAGTTAAATGCACCTCTTTATGG - Intergenic
1160391503 18:78537347-78537369 AGGTTAAATGCCACACTTAAAGG + Intergenic
1165393634 19:35551993-35552015 AGGGCAGATGCCCCATTTAAAGG + Intronic
926885164 2:17590540-17590562 AGGGTAAATGGCCATCTTAATGG + Intronic
929705342 2:44206064-44206086 AGTTTAGATGCCCTTATTTATGG + Intronic
931656807 2:64516996-64517018 AGGACAGATGCTCCTCTTGATGG + Intergenic
935521240 2:104107800-104107822 CGGTCAGATGCACCTCTTTATGG - Intergenic
937384651 2:121417541-121417563 AGGTAAGGTGCCCCACTCAAGGG + Intronic
941878185 2:170456109-170456131 TGGTTATATACCCTTCTTAAGGG + Intronic
942334750 2:174871201-174871223 TGGCTAGATGCTCCTCTTTAGGG - Intronic
943264021 2:185703296-185703318 AGGGTAGATGTCCCTTTGAATGG - Intergenic
945042972 2:205757811-205757833 AGGATAGAGGCCCTTCTTTAAGG + Intronic
945217211 2:207446601-207446623 AGGTAAGTTGCACCTCTTACAGG - Intergenic
946959532 2:224969267-224969289 ACGTTAGATGACTTTCTTAAGGG - Intronic
1172090405 20:32427720-32427742 AAGTTAGGTGCCCCTCTTCTGGG + Intronic
1175525566 20:59631160-59631182 GGGTCAGATGCCCATCTTAGGGG + Intronic
1176259588 20:64172468-64172490 ATGTGAGATGCCCCTCCTAGTGG + Intronic
1176797443 21:13380414-13380436 AGGTGAGAAGCGCCTCTTCACGG + Intergenic
1178089746 21:29150062-29150084 AGGTTACAAACCCCTCCTAAAGG - Intronic
1182115021 22:27751440-27751462 AGTTTAGATGCCCCTCCTCCAGG - Intronic
1183647117 22:39133334-39133356 AGGATAGAAGCCTCTCTGAAGGG + Exonic
949759801 3:7457773-7457795 AGCTTAGATGCCCCACTGATGGG + Intronic
953659730 3:44883339-44883361 AGATGAGGTGCCCCTCTAAAGGG + Intronic
964566871 3:158066278-158066300 AGGCTAAATGCCCCAATTAAAGG + Intergenic
965104372 3:164339298-164339320 GAGTTAGGTGGCCCTCTTAAGGG - Intergenic
967343958 3:188432784-188432806 AGGTTACAAGCTCCTTTTAAAGG - Intronic
967360672 3:188627316-188627338 GGGCTAAATGCCCCACTTAAAGG + Intronic
969059662 4:4424804-4424826 TGGTTAGCTGCCCTTCATAAGGG + Intronic
970679611 4:18491509-18491531 AGGATAAATGCCCCAATTAAAGG + Intergenic
977588213 4:98798951-98798973 AGGTCTGATGCACTTCTTAATGG - Intergenic
977671604 4:99701240-99701262 AGGCTAAATGCCCCAATTAAAGG + Intergenic
980308111 4:131091018-131091040 AGGTTATTTGCCCTTCCTAATGG - Intergenic
986576337 5:9216950-9216972 AGGCTAAATGCTCCCCTTAAAGG - Intronic
986903916 5:12470000-12470022 AGGCTAAATGCCCCACTTAATGG + Intergenic
990076895 5:51857035-51857057 AGGTTAAATGCAACTCATAAAGG + Intergenic
993263002 5:85684784-85684806 AGATTAGCTGCCACTCTAAATGG - Intergenic
1000838161 5:166181717-166181739 AGGTTAGATGCTATTCTAAATGG - Intergenic
1005594415 6:27365677-27365699 AGGTCAGATGCCCTTATTAAAGG - Intergenic
1006045156 6:31288935-31288957 GGATTAGATGCTCCTCTTCACGG + Intronic
1010878653 6:81140318-81140340 AGGCTAAATGCCCCAATTAAAGG + Intergenic
1014504199 6:122232573-122232595 AGGTTACCTGCCCCTCTTTCAGG - Intergenic
1015044820 6:128764328-128764350 GGCTTAAATGCCCCACTTAAGGG + Intergenic
1032537779 7:132678755-132678777 AGGTTAGATGCCCCTCTTAAAGG - Intronic
1033036128 7:137878019-137878041 AGCTCAGATGGCCCTTTTAAGGG - Exonic
1035625562 8:1068198-1068220 AACTGAGATGCCCCTCATAAGGG - Intergenic
1039111086 8:34041189-34041211 GAGTTAGATGCCCCTCCTATGGG - Intergenic
1043034747 8:75182120-75182142 GGTCTAGATGCCCCACTTAAAGG + Intergenic
1043070568 8:75631062-75631084 AGGTTAGAGGCCCAACTTAGGGG - Intergenic
1043437976 8:80252843-80252865 AGGCAAGATGCCCATCTCAATGG - Intergenic
1045505664 8:102776776-102776798 TGGTTAGATGCCCGTCCTAGTGG - Intergenic
1046797419 8:118388048-118388070 GGGTTAAATGCCCCTCTTATGGG - Intronic
1051908988 9:22131440-22131462 TGATTAGATGTCCCTTTTAAAGG + Intergenic
1185744751 X:2563757-2563779 AGGGGAGAAGCCCCTCTTAATGG - Intergenic
1188126492 X:26374890-26374912 GGGTTAGAGGCCCAACTTAAGGG - Intergenic
1193318589 X:80094009-80094031 AGTTTAGATGCTCCACTTACAGG + Intergenic
1194040931 X:88941258-88941280 GGGTTAGAGGCCCAACTTAAGGG - Intergenic
1196538192 X:116872522-116872544 AGATTAGATGCCCATATAAAAGG - Intergenic
1197649713 X:129051497-129051519 AGGTCAAATGCCCATATTAAAGG - Intergenic