ID: 1032537779

View in Genome Browser
Species Human (GRCh38)
Location 7:132678755-132678777
Sequence AGGTTAGATGCCCCTCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032537779_1032537782 23 Left 1032537779 7:132678755-132678777 CCTTTAAGAGGGGCATCTAACCT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1032537782 7:132678801-132678823 TCCTGAAGAAAGTAAAGTTTTGG No data
1032537779_1032537780 -7 Left 1032537779 7:132678755-132678777 CCTTTAAGAGGGGCATCTAACCT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1032537780 7:132678771-132678793 CTAACCTAGTGTTGAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032537779 Original CRISPR AGGTTAGATGCCCCTCTTAA AGG (reversed) Intronic