ID: 1032541352

View in Genome Browser
Species Human (GRCh38)
Location 7:132705660-132705682
Sequence GAATGTGATCACCCCAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032541352_1032541357 12 Left 1032541352 7:132705660-132705682 CCAGACCTGGGGTGATCACATTC 0: 1
1: 0
2: 0
3: 12
4: 232
Right 1032541357 7:132705695-132705717 GACACAGCCTTATATGCAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 162
1032541352_1032541354 -10 Left 1032541352 7:132705660-132705682 CCAGACCTGGGGTGATCACATTC 0: 1
1: 0
2: 0
3: 12
4: 232
Right 1032541354 7:132705673-132705695 GATCACATTCCTTCTCTCCAAGG 0: 1
1: 0
2: 2
3: 21
4: 220
1032541352_1032541359 19 Left 1032541352 7:132705660-132705682 CCAGACCTGGGGTGATCACATTC 0: 1
1: 0
2: 0
3: 12
4: 232
Right 1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG No data
1032541352_1032541360 20 Left 1032541352 7:132705660-132705682 CCAGACCTGGGGTGATCACATTC 0: 1
1: 0
2: 0
3: 12
4: 232
Right 1032541360 7:132705703-132705725 CTTATATGCAGAAGGAAACAGGG 0: 1
1: 0
2: 0
3: 31
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032541352 Original CRISPR GAATGTGATCACCCCAGGTC TGG (reversed) Intronic
901093015 1:6655593-6655615 GAGTGGGATCACCTGAGGTCAGG + Intronic
901363898 1:8728936-8728958 GCAGGTGATCATCCGAGGTCGGG + Intronic
902461208 1:16578470-16578492 GACTGTAATCACCCCTGCTCAGG - Intronic
902461990 1:16584766-16584788 GACTGTAATCACCCCTGCTCAGG - Intronic
902899349 1:19503456-19503478 GCAGGTGATCACCTGAGGTCAGG + Intergenic
903876680 1:26479572-26479594 GCAGGTGATCACCTGAGGTCGGG - Intergenic
904104818 1:28070330-28070352 GCAGGTGATCACCTGAGGTCAGG + Intronic
904221606 1:28975019-28975041 GCAGGTGATCACCTGAGGTCAGG - Intronic
904804531 1:33121333-33121355 GCAGGTGATCACCTGAGGTCAGG + Intergenic
906487732 1:46244682-46244704 GAATGTTTTCATCCCAGGTTGGG + Intergenic
906614943 1:47227600-47227622 GAATGCCAGCCCCCCAGGTCTGG + Intronic
906993371 1:50763025-50763047 GCAGGTGATCACCTGAGGTCAGG + Intronic
907419557 1:54337721-54337743 GCAGGTGATCACCTGAGGTCAGG - Intronic
907441121 1:54479116-54479138 GCAGGTGATCACCTGAGGTCAGG - Intergenic
909875253 1:80794486-80794508 GAAGGGGATCACCTGAGGTCAGG + Intergenic
913604210 1:120450100-120450122 GACTGTAATCACCCCTGCTCAGG + Intergenic
913641085 1:120812796-120812818 GACTGTAATCACCCCTGCTCAGG + Intronic
914277398 1:146137513-146137535 GACTGTAATCACCCCTGCTCAGG - Intronic
914365408 1:146973661-146973683 GACTGTAATCACCCCTGCTCAGG + Intronic
914487038 1:148119778-148119800 GACTGTAATCACCCCTGCTCAGG - Intronic
914538446 1:148588461-148588483 GACTGTAATCACCCCTGCTCAGG - Intronic
914587374 1:149074934-149074956 GACTGTAATCACCCCTGCTCAGG - Intronic
918491034 1:185081636-185081658 GCAGGTGATCACCTGAGGTCAGG - Intronic
923326181 1:232882213-232882235 GACTGTGATATTCCCAGGTCAGG - Intergenic
923326483 1:232884751-232884773 TATAGTGATCACCCCAGGTAAGG - Intergenic
924590022 1:245394917-245394939 GGGTGTGATCACCTGAGGTCAGG - Intronic
1064392725 10:14955474-14955496 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1065618139 10:27550043-27550065 GTAGGTGATCACCTGAGGTCAGG - Intergenic
1065873060 10:29972607-29972629 GCATGTGGTCACCTAAGGTCAGG + Intergenic
1067811534 10:49430808-49430830 GCATGCCTTCACCCCAGGTCAGG - Intergenic
1069002318 10:63279920-63279942 GTGGGTGATCACCTCAGGTCAGG + Intronic
1069524708 10:69159151-69159173 GAGTTTGATCACCTGAGGTCAGG + Intronic
1070967794 10:80540217-80540239 GAATGTGTGTATCCCAGGTCAGG + Intronic
1071132058 10:82405761-82405783 GAATGAGATCACTCCAGGCTAGG - Intronic
1071855908 10:89624075-89624097 GAATATGATCAGCCCGTGTCTGG - Intronic
1072136995 10:92556528-92556550 GCAGGTGATCACCTGAGGTCAGG + Intronic
1072192976 10:93091125-93091147 GAATGTGATCCACCCAGCTGTGG + Intergenic
1072597827 10:96891769-96891791 GCAGGTGATCACCTGAGGTCAGG - Intronic
1073200155 10:101728776-101728798 GCAGGGGATCACCCGAGGTCGGG + Intergenic
1073401820 10:103263822-103263844 GAATCTGATCAGCACAGCTCTGG - Intergenic
1073539829 10:104308972-104308994 GCATGTGATCTGCCTAGGTCCGG - Intergenic
1075516812 10:123115895-123115917 CAAGGGGATCACCCGAGGTCAGG - Intergenic
1077871527 11:6266261-6266283 GCAGGTGATCACCTGAGGTCGGG + Intronic
1079045262 11:17096264-17096286 GCAGGTGATCACCTGAGGTCAGG - Intronic
1079886390 11:25994389-25994411 GTGGGTGATCACCTCAGGTCAGG - Intergenic
1081234719 11:40633614-40633636 GGATGGGATCACCTGAGGTCAGG - Intronic
1083424874 11:62578316-62578338 GCAGGTGATCACCTGAGGTCGGG + Intronic
1084977369 11:72809497-72809519 GACTGCGATCACACCAGGACTGG - Intergenic
1086573770 11:88314753-88314775 GAAGCAGATCACCTCAGGTCAGG - Intronic
1088817107 11:113428948-113428970 AAATGTGAGCACTGCAGGTCAGG + Intronic
1090816625 11:130302743-130302765 GCAGGTGATCACCTGAGGTCAGG + Intronic
1093030292 12:14282254-14282276 GAAGCTGATCACCTGAGGTCAGG - Intergenic
1096418906 12:51439282-51439304 GCAGGTGATCACCTGAGGTCAGG - Intronic
1098058361 12:66533415-66533437 GCAGGTGATCACCTGAGGTCAGG + Intronic
1099675340 12:85754476-85754498 GAATGAGATCTCACCAGATCTGG + Intergenic
1100494495 12:95111941-95111963 GAATGTGATCAGGCCAGGTGTGG + Intronic
1102333409 12:112056104-112056126 GAAGCGGATCACCTCAGGTCAGG + Intronic
1102590530 12:113953258-113953280 GCGGGTGATCACCCGAGGTCAGG + Intronic
1102660320 12:114521455-114521477 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1103507278 12:121450084-121450106 GAGGGTGATCACCTGAGGTCAGG + Intronic
1103522287 12:121544380-121544402 GCAGGTGATCACCTGAGGTCAGG + Intronic
1103639754 12:122340305-122340327 GCAGGTGATCACCTGAGGTCAGG - Intronic
1103989870 12:124791726-124791748 GCAGGTGATCACCTGAGGTCAGG + Intronic
1106088430 13:26563425-26563447 GAGGCTGATCACCTCAGGTCAGG + Intronic
1106136454 13:26977160-26977182 CCACGTGATCACCCCAGGGCAGG + Intergenic
1106837331 13:33649019-33649041 GCAGGCGATCACCTCAGGTCGGG - Intergenic
1107127609 13:36861699-36861721 GCAGGGGATCACCCGAGGTCAGG + Intronic
1107937937 13:45361005-45361027 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1108553878 13:51573874-51573896 GAATGTGATGCCGCCAGGTGTGG + Intergenic
1109831495 13:67796391-67796413 GAATGTGATCATCGCAATTCAGG + Intergenic
1111007346 13:82264939-82264961 GAATGAAATCACCCCAGATTTGG + Intergenic
1111589678 13:90328179-90328201 GAATGTCATCTTCCCAGATCAGG + Intergenic
1112387073 13:98949745-98949767 TGATGTGTTCACCCCAGGTGAGG + Intronic
1115188077 14:30715341-30715363 GAAGCTGATCACCTAAGGTCAGG + Intronic
1115214560 14:31001935-31001957 GCAGGTGATCACCTGAGGTCGGG + Intronic
1115601077 14:34956466-34956488 GCAGGTGATCACCCAAGGTCAGG + Intergenic
1116802360 14:49456165-49456187 GAAGGTGATCACCTGAGGTCAGG + Intergenic
1117528376 14:56634612-56634634 GCAGGTGATCACCTGAGGTCAGG + Intronic
1118055834 14:62078667-62078689 GAGTGTGATCACACAAGATCAGG - Intronic
1118678073 14:68210185-68210207 GCAGGTGATTACCTCAGGTCAGG - Intronic
1120352719 14:83383544-83383566 GAAATTGATCACCTGAGGTCAGG - Intergenic
1120790531 14:88577018-88577040 GCAGGTGATCACCTGAGGTCAGG - Intronic
1122186670 14:100003642-100003664 GGCAGTGATCACCCAAGGTCAGG - Intronic
1123046980 14:105522525-105522547 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1202881409 14_KI270722v1_random:64246-64268 GTAGGTGATCACCTGAGGTCAGG - Intergenic
1124975297 15:34524296-34524318 AAATGGGAACACACCAGGTCGGG + Intergenic
1125522646 15:40356810-40356832 GAATGCCCCCACCCCAGGTCAGG + Intergenic
1127463425 15:59221236-59221258 GCAGGTGATCACCTGAGGTCAGG - Intronic
1128277651 15:66366951-66366973 GCAGGTGATCACTCGAGGTCAGG + Intronic
1128308287 15:66614280-66614302 GAATGGGAACACCCCAGGGGTGG + Intronic
1128876140 15:71202952-71202974 CAATGTGAGCTCCCCAGGGCAGG - Intronic
1129093035 15:73171867-73171889 GCAGGTGATCACCTGAGGTCAGG - Intronic
1129222502 15:74139546-74139568 GAATGTGAGCTCCCCATCTCTGG - Intergenic
1129767311 15:78178595-78178617 AAAGGTGAGCACCCCAGGCCAGG - Exonic
1129888171 15:79053036-79053058 GCAGGTGATCACCTGAGGTCTGG + Intronic
1130345951 15:83045265-83045287 GAGAGTGATCACCTGAGGTCAGG + Intronic
1130876742 15:88021189-88021211 GAATGTTACCACCCCAATTCGGG + Intronic
1133804718 16:9116043-9116065 CTATGTGATCACCTAAGGTCTGG - Intronic
1135297715 16:21297163-21297185 GCAGGTGATCACCTGAGGTCAGG + Intronic
1135745973 16:25016337-25016359 GAATGTGCTGACTCCAGGGCTGG - Intergenic
1137391935 16:48088654-48088676 GAAGGTGATCTCCCCACGGCTGG + Exonic
1138865629 16:60815774-60815796 TTATGTGATAACTCCAGGTCAGG - Intergenic
1139063751 16:63288219-63288241 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1141111534 16:81274648-81274670 GCAGGTGATCACCTGAGGTCAGG + Intronic
1141318227 16:82981728-82981750 GAATGTGAGCATCCCATGTGAGG - Intronic
1141991181 16:87611256-87611278 GAATGGGAGCACCACAGGGCAGG + Intronic
1142158052 16:88541825-88541847 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1142269224 16:89080449-89080471 GCATGTGGTGACCCCAGGCCTGG - Intergenic
1142718336 17:1760014-1760036 GCAGGTGATCACCTAAGGTCAGG + Intergenic
1144680902 17:17193628-17193650 GCAGGTGATCACCTGAGGTCAGG - Intronic
1145128101 17:20318293-20318315 GAATGTTATCCCCGCAGGGCGGG - Intronic
1147109708 17:38252970-38252992 GAAGGGGATCACCTGAGGTCAGG + Intergenic
1147321022 17:39646117-39646139 GCAGGTGATCACCTGAGGTCAGG - Intronic
1148419686 17:47534794-47534816 GAAGGGGATCACCTGAGGTCAGG - Intronic
1148812183 17:50300502-50300524 GAAAGAGCTCACCCCAGGTCTGG + Intergenic
1149356443 17:55844859-55844881 GCGGGTGATCACCTCAGGTCAGG + Intergenic
1149719318 17:58827358-58827380 GCAGGTGATCACCAGAGGTCAGG - Intronic
1152161713 17:78672929-78672951 TAATGTGATCCCCCAAGGCCAGG + Intergenic
1157206732 18:45707107-45707129 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1160670835 19:362207-362229 AAGTGTGATCAACCCAGGCCTGG - Exonic
1161082940 19:2320440-2320462 GAGGGTGATCACTCGAGGTCAGG + Intronic
1161313724 19:3608302-3608324 GAATAGGAGCTCCCCAGGTCTGG + Intergenic
1162274992 19:9646296-9646318 GCAGGTGATCACCTGAGGTCGGG - Intronic
1163541693 19:17915149-17915171 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1164557061 19:29261485-29261507 TAATCTGATCACCTGAGGTCCGG + Intergenic
1167378045 19:49122308-49122330 GCAGGTGATCACCTGAGGTCGGG - Intronic
1167487848 19:49773591-49773613 GAACGTGAGCACCCTAGGGCAGG - Intronic
1167762730 19:51459432-51459454 GAAGGTGCACACCCCAGGGCTGG - Intergenic
1168027903 19:53656872-53656894 GAAGGTGATCACCTGAGGTCAGG - Intergenic
1202657022 1_KI270708v1_random:33348-33370 GTAGGTGATCACCTGAGGTCAGG - Intergenic
1202677643 1_KI270711v1_random:22210-22232 GACTGTAATCACCCCTGTTCAGG - Intergenic
927429869 2:23018520-23018542 GCGTGTGATCACCTGAGGTCAGG + Intergenic
928548180 2:32347703-32347725 GCAGGTGATCACCTGAGGTCAGG - Intergenic
929217254 2:39428443-39428465 GCAGGTGATCACCTGAGGTCAGG + Intronic
929441969 2:41971776-41971798 GAGTGTGATCACAGCTGGTCTGG - Intergenic
930028369 2:47043589-47043611 GAAGGTGAGGACCACAGGTCAGG + Intronic
931614138 2:64138497-64138519 GTAGGTGATCACCTGAGGTCAGG + Intronic
932010962 2:67977015-67977037 GACTGTGACCACCCCAGACCTGG + Intergenic
932028530 2:68159434-68159456 AGATGTGATCACCTGAGGTCAGG - Intronic
936116732 2:109708746-109708768 GCAGGTGATCACCTGAGGTCAGG + Intergenic
937110169 2:119360250-119360272 GCAGGTGATCACCTGAGGTCAGG + Intronic
937795990 2:126020897-126020919 GAATGTGATGTCCCCAGCTTTGG + Intergenic
938419117 2:131129729-131129751 GTAGGTGATCACCTGAGGTCAGG - Intronic
939410878 2:141823284-141823306 GATTGTGAGCACTTCAGGTCTGG + Intronic
941954865 2:171193945-171193967 GCAGGTGATCACCTGAGGTCAGG - Intronic
946326625 2:218987816-218987838 GAGGGTGATCACCTGAGGTCAGG + Intergenic
1172222913 20:33286016-33286038 CTCTGTGCTCACCCCAGGTCTGG + Exonic
1172680243 20:36708420-36708442 GAAGTGGATCACCCAAGGTCAGG + Intronic
1174000307 20:47369738-47369760 GTGTGTGATCACCTGAGGTCAGG + Intergenic
1174398534 20:50262911-50262933 GCAGGTGATCACCCGAGGTCAGG - Intergenic
1175598784 20:60256223-60256245 GAATGTGAGCCCCCCAGGGTGGG - Intergenic
1179578109 21:42320282-42320304 GCATGCCATCAGCCCAGGTCTGG - Intergenic
1180006660 21:45025717-45025739 GAATGTCAACACACCAGGGCTGG + Intergenic
1181521374 22:23450515-23450537 GACTGTGCTAACCCCAGGGCTGG + Intergenic
1182106091 22:27690632-27690654 TAATATCATCACCCCTGGTCTGG - Intergenic
1182416488 22:30224570-30224592 GAATGGAGACACCCCAGGTCTGG + Intergenic
1182756934 22:32687903-32687925 AAATGTCACCATCCCAGGTCAGG + Intronic
1182766471 22:32761428-32761450 GAATGTCAACACCCCAGGGCAGG + Intronic
1182795536 22:32989100-32989122 GAATTTGATCTCCCCAGGTAAGG + Intronic
1183022869 22:35041153-35041175 ACAGGTGATCACCCGAGGTCAGG + Intergenic
1183198031 22:36366837-36366859 GAAAGTGATCACCCCTGGGGTGG + Intronic
1183936479 22:41265361-41265383 GCATCTGCTCACCTCAGGTCTGG - Intronic
1185027113 22:48421064-48421086 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1185159845 22:49216868-49216890 GAATATGAGGGCCCCAGGTCAGG + Intergenic
952437579 3:33287398-33287420 AAATGTGATCAGCCCAGAACTGG - Intronic
956262064 3:67355195-67355217 GTATGTAGTCACCCCAGCTCTGG + Intergenic
957097383 3:75788917-75788939 GAAGGTGATCACCTGAGGTCAGG + Intergenic
958164452 3:89861730-89861752 CTATGTTATCAACCCAGGTCAGG + Intergenic
958943353 3:100337679-100337701 GCAGGTGATCACCTGAGGTCAGG - Intronic
961608979 3:128121480-128121502 GCAGGTGATCACCTGAGGTCAGG + Intronic
961830237 3:129619480-129619502 GAATGAGATCACAGCAGGCCCGG - Intergenic
961856334 3:129875258-129875280 GCAGGTGATCACCTAAGGTCAGG + Intronic
962435720 3:135364941-135364963 GAATGTGAGCCCTTCAGGTCAGG + Intergenic
967329350 3:188275157-188275179 GAAAGTGATGACCCAAAGTCAGG - Intronic
967469434 3:189844511-189844533 GAGTCAGATCACCTCAGGTCAGG - Intronic
968538404 4:1149685-1149707 GCATGTGATCACTTGAGGTCAGG - Intergenic
968677344 4:1890823-1890845 GCAGGTGATCACCTGAGGTCAGG - Intronic
971617040 4:28804288-28804310 GTAGGTGATCACCTGAGGTCAGG + Intergenic
973360178 4:49157935-49157957 GCAGGTGATCACCTGAGGTCAGG - Intergenic
973399905 4:49629971-49629993 GCAGGTGATCACCTGAGGTCAGG + Intergenic
975146075 4:70968537-70968559 GCAGGTGATCACCTGAGGTCAGG - Intronic
975569679 4:75802039-75802061 GGAAGGGATCACCCGAGGTCAGG - Intronic
977097060 4:92759852-92759874 GCAGGTGATCACCTGAGGTCAGG - Intronic
977936797 4:102815270-102815292 CAAGGTGATCACCTGAGGTCAGG - Intronic
979463641 4:121011245-121011267 GAATGTGAGCTCCACAGGGCAGG - Intergenic
985863853 5:2495961-2495983 GAATGTGCCCTCCCCAGTTCTGG - Intergenic
986174253 5:5338569-5338591 GCATGGGATCACCTGAGGTCGGG - Intergenic
986298954 5:6463235-6463257 GAATGTACTCACCCCATTTCAGG - Intronic
988787818 5:34580430-34580452 GCAGGTGATCACCTGAGGTCAGG - Intergenic
988963605 5:36393319-36393341 GCAGGCGATCACCCGAGGTCAGG + Intergenic
991198428 5:63961695-63961717 GGATGTGCTCAGCCCTGGTCAGG - Exonic
991246592 5:64514708-64514730 GAAAGTGAACACCCCGGGTGTGG - Intronic
993371536 5:87098664-87098686 GATGGTGATCACCTGAGGTCAGG + Intergenic
994037742 5:95222092-95222114 GGAGGTAATCAGCCCAGGTCTGG + Intronic
996561774 5:124837740-124837762 GAATTGGATCACCTGAGGTCAGG + Intergenic
998232373 5:140369030-140369052 GAGTATGATCAGCCCAGGTGCGG + Intronic
1000327824 5:160185627-160185649 TAATGTGCTCCCCCCAGGTGAGG - Intergenic
1001406586 5:171481364-171481386 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1003091826 6:3110434-3110456 GCAGGTGATCACCTGAGGTCAGG - Intronic
1004123304 6:12847207-12847229 GAATGTGATTATACCAGGTGTGG - Intronic
1005258698 6:24033462-24033484 GAATGTGACCAATCCAGGCCTGG + Intergenic
1005862955 6:29915320-29915342 GAATGAGATTACTCCAGGTCTGG + Intergenic
1005874469 6:30000508-30000530 GAATGAGATTACTCCAGGTCTGG + Intergenic
1007469796 6:42081732-42081754 GCAGGTGATCACCTGAGGTCAGG - Exonic
1009171117 6:60401028-60401050 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1018314158 6:162540577-162540599 GCAGGTGATCACCTGAGGTCAGG + Intronic
1018615806 6:165685713-165685735 GGCTGGGCTCACCCCAGGTCAGG - Intronic
1019589931 7:1825869-1825891 GACTGTGCTCATCCCAGGGCTGG - Intronic
1020827858 7:13054108-13054130 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1022030324 7:26486781-26486803 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1023932931 7:44717530-44717552 GAATGTCATCACCCCTATTCTGG - Intergenic
1025077699 7:55957283-55957305 GGATGGGATCACCTGAGGTCAGG - Intronic
1026021815 7:66713599-66713621 GAATGTGTTCACCCAAGTTAAGG - Intronic
1027203505 7:76078798-76078820 CAAGGTGATCACCTGAGGTCAGG - Intergenic
1027380547 7:77604440-77604462 GCAGGTGATCACCTGAGGTCAGG - Intronic
1030324140 7:108202199-108202221 GAAGGCCATCACCCCAGTTCTGG - Intronic
1032197453 7:129797587-129797609 TAATGTGATCCCCCCAGGGGAGG - Intergenic
1032541352 7:132705660-132705682 GAATGTGATCACCCCAGGTCTGG - Intronic
1033237995 7:139653607-139653629 GATTTTCATCACACCAGGTCAGG - Intronic
1033648502 7:143322747-143322769 GCAGGTGATCACCCGAGGTCAGG - Intronic
1034349927 7:150408956-150408978 GAGTGTGAGCACCCCGTGTCAGG - Intronic
1036822443 8:11951689-11951711 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1036924173 8:12888155-12888177 GAAGGTGATCACTTGAGGTCAGG - Intergenic
1039744656 8:40413429-40413451 GAATCTGATCACGCCAACTCTGG + Intergenic
1042422740 8:68611092-68611114 AAGTGTGATCACCTGAGGTCGGG - Intronic
1045275457 8:100700409-100700431 GAGGGTGATCACCTGAGGTCAGG + Intronic
1047479656 8:125269312-125269334 GAAGGTGATCACTTGAGGTCAGG - Intronic
1048787224 8:138063270-138063292 GCAGGTGATCACCTGAGGTCGGG - Intergenic
1050514306 9:6426974-6426996 GCAGGTGATCACCTGAGGTCAGG - Intronic
1052930921 9:34054815-34054837 GAATGTGATAATACGAGGTCAGG + Intergenic
1053260943 9:36663306-36663328 TCATGTGATCACCTGAGGTCAGG - Intronic
1055443248 9:76357287-76357309 GAGGGTGATCACCTGAGGTCAGG + Intronic
1057520908 9:95759564-95759586 GAATGTTATCACACCAGTTGTGG - Intergenic
1060346119 9:122817201-122817223 GCAGGTGATCACCTGAGGTCAGG + Intronic
1061025892 9:128049208-128049230 GCGGGTGATCACCTCAGGTCAGG + Intergenic
1203689221 Un_GL000214v1:27017-27039 GCAGGTGATCACCTGAGGTCAGG - Intergenic
1203647054 Un_KI270751v1:77036-77058 GCAGGTGATCACCTGAGGTCAGG + Intergenic
1185512634 X:674838-674860 AAAGGTGATCACCTGAGGTCAGG - Intergenic
1185955001 X:4479520-4479542 CAAGGTGATCACCTGAGGTCAGG - Intergenic
1189787081 X:44568767-44568789 GCAGGTGATCACCTGAGGTCGGG + Intergenic
1194646480 X:96464386-96464408 GTAGGTGATCACCTGAGGTCTGG - Intergenic
1195783277 X:108487161-108487183 GCAGGTGATCACCGGAGGTCAGG + Intronic
1196699900 X:118656733-118656755 GTAGGTGATCACCTGAGGTCAGG + Intronic
1197713705 X:129690349-129690371 GCATGTGATCTCTCCAGGGCTGG + Intergenic
1198521301 X:137455470-137455492 CACTGTGATCACCCCAGGAAAGG - Intergenic