ID: 1032541355

View in Genome Browser
Species Human (GRCh38)
Location 7:132705682-132705704
Sequence AGGCTGTGTCCTTGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032541355_1032541359 -3 Left 1032541355 7:132705682-132705704 CCTTCTCTCCAAGGACACAGCCT 0: 1
1: 0
2: 3
3: 35
4: 337
Right 1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG No data
1032541355_1032541357 -10 Left 1032541355 7:132705682-132705704 CCTTCTCTCCAAGGACACAGCCT 0: 1
1: 0
2: 3
3: 35
4: 337
Right 1032541357 7:132705695-132705717 GACACAGCCTTATATGCAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 162
1032541355_1032541361 28 Left 1032541355 7:132705682-132705704 CCTTCTCTCCAAGGACACAGCCT 0: 1
1: 0
2: 3
3: 35
4: 337
Right 1032541361 7:132705733-132705755 CTTGTCTCCAGTCTCCCCAAAGG No data
1032541355_1032541360 -2 Left 1032541355 7:132705682-132705704 CCTTCTCTCCAAGGACACAGCCT 0: 1
1: 0
2: 3
3: 35
4: 337
Right 1032541360 7:132705703-132705725 CTTATATGCAGAAGGAAACAGGG 0: 1
1: 0
2: 0
3: 31
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032541355 Original CRISPR AGGCTGTGTCCTTGGAGAGA AGG (reversed) Intronic
900103323 1:971963-971985 TGGCTGGGTACTTGGAGAGCTGG - Intronic
901078252 1:6569095-6569117 AGGCAGGGTGGTTGGAGAGAGGG + Intronic
901232854 1:7650939-7650961 AGGCTGTCTCCATGGCGACAAGG - Intronic
901476720 1:9495087-9495109 GGGGTGTGTCCTGGGAGAGCCGG + Intergenic
902515621 1:16987988-16988010 CGGCTGTGTGGTTGGAGAGGTGG - Intronic
902521325 1:17018654-17018676 AGTCCTTGTCCTTGGAGAGATGG - Intergenic
902632086 1:17710984-17711006 ATCCTGTGTCCTTTGAGGGAAGG + Intergenic
902654273 1:17856794-17856816 GGGCTGTGTGCTGGGAGAGGGGG + Intergenic
903398396 1:23019960-23019982 AGGCGGTGTCGTTTGAGGGAAGG - Intronic
903787577 1:25871637-25871659 AGTGTGTATCCTTGGAGAGCAGG - Intergenic
905527559 1:38650554-38650576 AGGCTGTGTTATCTGAGAGATGG - Intergenic
906148578 1:43574738-43574760 AGGCTGGGACCTGGGAGTGAGGG - Intronic
908430593 1:64053009-64053031 TGCCTGTCCCCTTGGAGAGAAGG - Intronic
909199362 1:72669976-72669998 AGCCTGTGTACTTGGAGAATGGG - Intergenic
911204661 1:95080227-95080249 AGGCTGTGTCCCTGAACTGAAGG + Intergenic
912806182 1:112758767-112758789 AGCCTATGTCCATGGGGAGAGGG - Intergenic
913199014 1:116481435-116481457 AGGCTGTTTCATTGAAGAAATGG + Intergenic
914923422 1:151862977-151862999 AGACTGTGTTTTGGGAGAGAAGG + Intergenic
916581531 1:166113748-166113770 AGGGTGTTTCCTGGGACAGAAGG + Intronic
916970753 1:170012635-170012657 GGGCTGGGTCCTTTGAGAGGTGG + Intronic
917576776 1:176330844-176330866 AGACTGAGTGCATGGAGAGAGGG + Intergenic
917710491 1:177679551-177679573 GCGCTGTGTTCTTGGGGAGAGGG - Intergenic
917845971 1:179020446-179020468 AGGATGAGCGCTTGGAGAGATGG + Intergenic
918108146 1:181430812-181430834 AGGCTGAGTCCTGGGATAGTTGG + Intronic
918584240 1:186167400-186167422 AGGCTGTGTGTGTGGAGGGAAGG - Intronic
920044102 1:203122409-203122431 ATGCTTTGTGCTTGCAGAGATGG - Intronic
921307707 1:213813665-213813687 AGGCTGTGTTCTTCAGGAGAAGG + Intergenic
921754172 1:218834317-218834339 TGGCAGTGTCATGGGAGAGAGGG + Intergenic
922822454 1:228493699-228493721 AGGCTTTGGCCCTGGGGAGACGG + Intronic
923110907 1:230889260-230889282 AGGCTAGGTCCATGGACAGAGGG + Intergenic
923273753 1:232379449-232379471 GGGCTGGGACCTTGGAGAGTTGG + Intergenic
924264060 1:242262996-242263018 AGTTTGAGACCTTGGAGAGATGG + Intronic
924813847 1:247425967-247425989 AGTCTGTGTCCCAGGAGCGAGGG + Intronic
1063882546 10:10545966-10545988 TGGCTGTGTTCCTGGAGAAAGGG + Intergenic
1063897667 10:10699419-10699441 AGTTTTTGTCCTTGTAGAGATGG + Intergenic
1064845880 10:19652490-19652512 AAGCTTTATCCTTGGAGAAATGG + Intronic
1066720737 10:38335468-38335490 AGTTTGAGACCTTGGAGAGATGG - Intergenic
1068039825 10:51809800-51809822 AGGCTTTCTCCTAGGAGTGATGG - Intronic
1068686815 10:59878925-59878947 AGTTTGTGTGCTTGGAGGGAAGG + Intronic
1068744004 10:60508473-60508495 AGTGTGTGTCCTAAGAGAGAGGG - Intronic
1069694471 10:70376669-70376691 AGCCTGGGTCCTGGGGGAGAAGG - Intronic
1069806295 10:71127095-71127117 AGGCTGTGTCCTAGCAGGAATGG - Intergenic
1070404847 10:76085618-76085640 ACCCTGTGTCCTTGGAGAGTCGG + Intronic
1071808078 10:89146092-89146114 AGGAAGTGACCATGGAGAGATGG - Intergenic
1073486558 10:103822715-103822737 AGGATTGTTCCTTGGAGAGAGGG - Intronic
1074111437 10:110425410-110425432 GGGCTGTGTGCTTAGGGAGATGG + Intergenic
1074263320 10:111875729-111875751 AGGCTGTGGCCTTGCAAATAGGG - Intergenic
1074854317 10:117462174-117462196 AGGCTGTCTGCCTGCAGAGATGG + Intergenic
1075224720 10:120617970-120617992 TGGCTGTGTACAGGGAGAGAGGG + Intergenic
1075595287 10:123724892-123724914 AGCCTGGGTGCTGGGAGAGAAGG + Intronic
1075624436 10:123951428-123951450 AGGGTGTGTCAGTGGGGAGAAGG + Intergenic
1076374623 10:129974855-129974877 AGACTGCAGCCTTGGAGAGAGGG - Intergenic
1077680545 11:4236753-4236775 AGGCAATGTCCCTGGATAGAAGG - Intergenic
1077684830 11:4282175-4282197 AGGCAATGTCCCTGGATAGAAGG - Intergenic
1077690361 11:4335755-4335777 AGGCAATGTCCCTGGATAGAAGG + Intergenic
1078471467 11:11590337-11590359 AGCCTATGTCCTTGGATGGAAGG + Intronic
1078507647 11:11964678-11964700 AGGCTGTGGCTGGGGAGAGATGG + Exonic
1079351130 11:19693019-19693041 AGGCTATGAGCTTGGAGAGAAGG - Intronic
1079488646 11:20962864-20962886 GGGATGTGTTCTTGGAGAGAAGG + Intronic
1080240900 11:30126152-30126174 AGGCTCTGCCCTTGTAGAGTAGG - Intergenic
1081297384 11:41408579-41408601 TGGCTGTGTCCTATGAAAGAGGG - Intronic
1081498098 11:43636341-43636363 GGGCTGTGTCCTAGGAGGAAAGG + Intronic
1081761900 11:45582423-45582445 AGGCAGTGACCATGGAGACAGGG + Intergenic
1083472692 11:62894791-62894813 AGGCTGTGGATTTGGAGAGAAGG + Intergenic
1084190234 11:67495338-67495360 AGGCTGTGTGCTGGGGGAAAGGG + Intronic
1084290440 11:68162136-68162158 AGGCTGTGGCTTTCGAGACAGGG - Intronic
1084350282 11:68592948-68592970 AGACTGTGTCCTGGGGGAGATGG + Intronic
1084465596 11:69321215-69321237 AGGCTGTGTCCCTAGACTGAAGG + Intronic
1085453046 11:76648387-76648409 AGGCACTGACCTGGGAGAGAAGG - Intergenic
1088754070 11:112871328-112871350 AGGAAGTTTCCTTGGAGAAATGG - Intergenic
1089422807 11:118344301-118344323 GGGCTGGGGCCTTTGAGAGAAGG - Intergenic
1089860061 11:121582110-121582132 AGCCTTGGTCCTTGGAGAGATGG + Intronic
1090282792 11:125470619-125470641 AGGCTGTGTGTTTTGAAAGAAGG + Intronic
1091382442 12:70756-70778 TGCCTGTGGCCTTGGAGACATGG - Intronic
1092026403 12:5244574-5244596 ACGGTGTGTCCTGGGAGATAAGG - Intergenic
1092074672 12:5663228-5663250 AGTCTGTGTCCTTGGCACGAGGG + Intronic
1092840772 12:12539271-12539293 AGGCTGTGACATTGGAGAACTGG - Intronic
1093788668 12:23221284-23221306 TGGCTGTGTCCTTTTACAGAGGG + Intergenic
1094071062 12:26413121-26413143 AGTCTGTGAACTTAGAGAGAAGG - Intronic
1094321555 12:29189479-29189501 AGCCAGAGTCCTTGGAGAAATGG - Intronic
1094447697 12:30549595-30549617 AGTCTATTTCCTTGGAAAGAAGG + Intergenic
1095194590 12:39298114-39298136 AGGCTGTGATCCTGGAGAAAAGG + Intronic
1095922718 12:47546673-47546695 ACCCTGTGTCCCTGGAGAGGTGG - Intergenic
1096836810 12:54356409-54356431 AGGGTGTGTGCTTGAGGAGAGGG + Intergenic
1097038887 12:56142512-56142534 GGGCCGTGTCCTTAGAGTGAGGG + Intronic
1098442534 12:70533775-70533797 AGGCTGTGTCCTCACATAGAGGG - Intronic
1100326392 12:93543669-93543691 AGGCTCTGTCCCTGGAGAGTTGG - Intergenic
1100438818 12:94596632-94596654 TGGATGCCTCCTTGGAGAGAAGG + Intronic
1101742178 12:107509205-107509227 AGGCTGACCCCTGGGAGAGAAGG + Intronic
1101879882 12:108618860-108618882 TGGCTGTGGCTTGGGAGAGAGGG - Intergenic
1102458577 12:113086505-113086527 GGGCTGTGTGTTGGGAGAGACGG + Intronic
1102568291 12:113811616-113811638 AGGCTGTGTCCTTGAAGGGCAGG + Intergenic
1102590187 12:113950893-113950915 AGGGTGTGGCCATGGAGAGGGGG - Intronic
1102744997 12:115242616-115242638 AGGCGGGGACCTTGGAAAGAAGG - Intergenic
1103951604 12:124554474-124554496 TGGCTTTTGCCTTGGAGAGAGGG - Intronic
1103955511 12:124574272-124574294 GGGCTGTCCCATTGGAGAGATGG - Intergenic
1104561965 12:129853800-129853822 AGGATGTGTTCTAGGGGAGAGGG + Intronic
1104986489 12:132600505-132600527 AGGCTGTGTCCCTGAGGAGCAGG + Intergenic
1105434325 13:20363697-20363719 AGGCACTCTCCTAGGAGAGAGGG - Intergenic
1105475999 13:20728656-20728678 AGTCTGTCTCCTTGGAGGGCTGG + Intergenic
1106468543 13:30034272-30034294 AGGATGTCTGCTTGCAGAGAGGG + Intergenic
1107635134 13:42384691-42384713 CGGCTGTGGCTTTGGAGATATGG - Intergenic
1110278006 13:73661241-73661263 ATGGTGTGGCCTCGGAGAGAGGG - Intergenic
1111622685 13:90744730-90744752 AGAGAGAGTCCTTGGAGAGAAGG - Intergenic
1111732675 13:92096694-92096716 TTGCTGTGTCCTTAGAGAGCAGG - Intronic
1112213148 13:97401455-97401477 ACTCTGTGTCCTTTGAGAAATGG - Intergenic
1112384137 13:98922137-98922159 AGGCAGCATCCTAGGAGAGAAGG + Exonic
1112935749 13:104795839-104795861 CGACTGTATCATTGGAGAGAAGG + Intergenic
1113537621 13:111080826-111080848 ACGCTGTGTCCTTGCAGGGCAGG - Intergenic
1113739759 13:112703237-112703259 AGGCTGTGTCCTCCCAGAGGCGG + Intronic
1114473941 14:22981502-22981524 CGGCGGGGCCCTTGGAGAGACGG - Exonic
1114552406 14:23540471-23540493 AGGAGGTGACCATGGAGAGAAGG + Intronic
1115395590 14:32904913-32904935 TGGCTGTGACCTTGAAGAGTAGG + Intergenic
1115722193 14:36175278-36175300 AGGCTGTGCTCCTTGAGAGAAGG - Intergenic
1116553366 14:46271082-46271104 AGGCTGAGTACTAGGAAAGAAGG + Intergenic
1118442981 14:65828697-65828719 AGTGTGTGGCCTTGGAGAAATGG + Intergenic
1121032835 14:90674231-90674253 AGGATGTGGCCTCGGACAGAGGG + Intronic
1121257087 14:92538986-92539008 GGGGTCTGTCCTTGCAGAGATGG + Intronic
1121317130 14:92968954-92968976 AGTCTGTGTCCACTGAGAGATGG - Intronic
1121507687 14:94489297-94489319 CGGATGTGGCCTTTGAGAGAGGG + Intronic
1122292904 14:100688910-100688932 GGGCAGTGTCCCTGGAGGGAGGG + Intergenic
1122601561 14:102924176-102924198 AGGCTGTGTCCTGGGAGGGATGG + Intronic
1123134062 14:106011442-106011464 TGGCTCTGTATTTGGAGAGAGGG - Intergenic
1124787628 15:32696523-32696545 AGTCTCTGTCCTTGTAGATATGG - Exonic
1126739685 15:51764971-51764993 AAGCTGTGATCTTGGGGAGAGGG + Intronic
1128055031 15:64692973-64692995 AGGCTATGTGCTGGGAGAGGAGG + Intronic
1128160726 15:65421700-65421722 AGGATGTGTCCGGGGAGAGTCGG - Intronic
1128382925 15:67126628-67126650 GGGCTCTGTCCTTGGGGAGCTGG - Intronic
1129328841 15:74816459-74816481 AGGCTCTGTCCTTGGGGGGCTGG + Exonic
1130182548 15:81645257-81645279 AGGAGGGCTCCTTGGAGAGATGG - Intergenic
1130305880 15:82711788-82711810 AGGCTGTGTAGTTGGAGGGCAGG - Intergenic
1131025494 15:89137953-89137975 GGGCTGTGTCCTAGTGGAGAAGG + Intronic
1131048169 15:89329223-89329245 AGGCTGTGTGCTGGGAGGGGAGG - Intronic
1132324208 15:100953574-100953596 AACCTGTGTCCTTTGACAGATGG - Intronic
1133563252 16:6968963-6968985 AGGATGTGTACTTTGAGGGAAGG + Intronic
1133717071 16:8460001-8460023 AGGCAATGTCCTTAGAGGGACGG + Intergenic
1133720906 16:8493495-8493517 AGGATATCACCTTGGAGAGAAGG - Intergenic
1133747005 16:8694830-8694852 GGGCTGTGTCCTGGCAGAGAAGG + Intronic
1135919906 16:26640554-26640576 GGGGTGTGTGTTTGGAGAGATGG + Intergenic
1137759386 16:50928129-50928151 AGGCTGTGGCATTTGAGGGATGG + Intergenic
1139532018 16:67547066-67547088 AGGCTGTGGCCTGGGAGCAAAGG + Intergenic
1140049163 16:71464332-71464354 ATGCTGTGTCCTTAAAGACAAGG + Intronic
1140769066 16:78187089-78187111 AGGGTGTTTCTTTGGGGAGATGG - Intronic
1140877600 16:79167426-79167448 TGGCTCTGACCTTGGAGACAGGG + Intronic
1141804906 16:86336087-86336109 AGCCTGTGTGCTGGGAGGGATGG - Intergenic
1143405722 17:6676073-6676095 AGGCTGTATCCTTGAGGACAGGG + Intergenic
1143585782 17:7849486-7849508 AGCCTCTGTCCCTGGAAAGAAGG + Exonic
1144572481 17:16408147-16408169 ATTCTGGGTCCTGGGAGAGACGG + Intergenic
1146121357 17:30198315-30198337 AGACTGTGTCCCTGTGGAGAAGG + Exonic
1147689756 17:42307966-42307988 AGGCTGGGTCGTGGCAGAGAGGG - Intronic
1147718349 17:42522689-42522711 AAGCTGTGGCCTTTGATAGAAGG - Intergenic
1148391685 17:47277096-47277118 AGGGTGTGTTCTTGGAGGGTTGG + Intronic
1148700728 17:49585263-49585285 AGGCTGTGTGCCTTGAGACAGGG - Intergenic
1148911975 17:50947683-50947705 CTGCTGTGTTTTTGGAGAGAGGG - Intergenic
1150142809 17:62744333-62744355 AACCTTTGTCCTTGGAGAGGAGG - Intronic
1150480435 17:65504721-65504743 AAGCTGTGAGCCTGGAGAGAGGG - Intergenic
1151439711 17:74120263-74120285 AGGCTGTGTGCTTGGGCAGCTGG + Intergenic
1151598797 17:75093913-75093935 AGCCTGTGGCCTCAGAGAGAGGG - Intronic
1152210802 17:79002009-79002031 AGGCTGTGTGGATGGGGAGAAGG - Intronic
1157190321 18:45576234-45576256 AGTCTGGGTGTTTGGAGAGAAGG + Intronic
1157196592 18:45624833-45624855 AGGATGTTTCCTGGGAGGGAGGG + Intronic
1157465153 18:47937603-47937625 AGGCAGTGAGCTTGGAGAGGAGG - Intergenic
1157549250 18:48569853-48569875 ATGCTGTGTCCTAGGACAGCAGG - Intronic
1157587451 18:48813820-48813842 ATGCTGTGTCCTTTAAGGGATGG - Intronic
1158645058 18:59238565-59238587 AGGCTGAGTGCTTTGAGAGAAGG - Intergenic
1158872681 18:61703450-61703472 ACTCTGTCTCCTTGGGGAGATGG + Intergenic
1158873880 18:61714221-61714243 AGGTTGTGTCCTGGGAGATAAGG - Intergenic
1159543129 18:69805307-69805329 AGGTTGTGTCCTTTTATAGAGGG + Intronic
1159976006 18:74712593-74712615 AGGCTGTCTCCCTGGAGGCAGGG + Intronic
1160208483 18:76857203-76857225 GCGCTGGGTCCTGGGAGAGAAGG - Intronic
1160516373 18:79481345-79481367 AGGCGGTGTCCGTGGAGGGTGGG - Intronic
1160608032 18:80066796-80066818 AGGCTGTGTTTTTAGAGATAGGG + Intronic
1160744919 19:706638-706660 AAGTTCTGTCCTTGGAGAGACGG - Intergenic
1160920571 19:1518339-1518361 ATGCTGCGTCCATGGAGAGAAGG + Intergenic
1162369130 19:10268557-10268579 GGGCAGTGTCCTTGGAGAAAGGG - Intergenic
1162849120 19:13417101-13417123 AGGCTGCCCCCTTGGGGAGAGGG - Intronic
1163234892 19:16024468-16024490 GGGCTGTGGGCTTGCAGAGATGG - Intergenic
1164455384 19:28402567-28402589 ACGCTGGGTCCTTGGAGACACGG + Intergenic
1164583537 19:29450315-29450337 AGCCTGTGTTCATGGAGGGAAGG - Intergenic
1164677366 19:30110633-30110655 GGGGTCTGTCCTTGCAGAGACGG + Intergenic
1164839602 19:31382535-31382557 GCTCTGTGTCCTTGGAGAGAGGG + Intergenic
1165049482 19:33132433-33132455 CGGTTCTGACCTTGGAGAGAGGG - Exonic
1166824893 19:45602407-45602429 GGGGTGTGTGGTTGGAGAGAGGG - Intergenic
1167393283 19:49210906-49210928 AGGCAGGGTCCTGGGAGGGAGGG + Intronic
925764298 2:7215762-7215784 AGTCTCTGTCATTGCAGAGAGGG + Intergenic
928235081 2:29532235-29532257 AGGCTGGGTGCATGCAGAGAAGG - Intronic
928269460 2:29843138-29843160 AGGTTGTGTTCATGGAGAGGAGG + Intronic
928911318 2:36424539-36424561 GGGCTGTGTCCTTGGGAAGTAGG + Intronic
929336038 2:40746731-40746753 AGGATGTGTCTTTGAAAAGAAGG - Intergenic
929588262 2:43129618-43129640 AGGCTGGGGCCCTGCAGAGAAGG - Intergenic
929613876 2:43292917-43292939 AGCCTCTGGACTTGGAGAGAAGG - Exonic
929810922 2:45188666-45188688 AGGCAGTGTTCCTGGAGGGAGGG - Intergenic
929879165 2:45821567-45821589 AGGATGTGCCCTAGGAAAGAAGG + Intronic
930000734 2:46859955-46859977 CGGCTGTGTCCTATGACAGAAGG - Intergenic
930187023 2:48420564-48420586 GGGCTGTGCCCCTGCAGAGAGGG + Intergenic
931431135 2:62209794-62209816 AGGCTGTGATGTTGGAGGGAAGG + Intronic
931513492 2:63025567-63025589 GGGCTGTAGCTTTGGAGAGAAGG + Intronic
932237975 2:70136302-70136324 AGGTTGTGTCCCAGGAGATAAGG - Intergenic
932320657 2:70819904-70819926 AGGCAGTGTCCAAGGTGAGAGGG + Intronic
932380705 2:71279213-71279235 ATGTTGAGGCCTTGGAGAGAGGG - Intronic
932564971 2:72900494-72900516 AGGCAGCGTGCTGGGAGAGAGGG - Intergenic
932705406 2:74020711-74020733 GGGCTATGCCCTTGGAGAGAAGG + Intronic
933148623 2:78888191-78888213 AGGAACTGTCCTTGGAGAAAGGG - Intergenic
934519164 2:95008537-95008559 AGGCTGGGCCCATGGAGAGCAGG - Intergenic
934761610 2:96859890-96859912 AGGCTGTGTGAGGGGAGAGAAGG - Exonic
935745342 2:106185467-106185489 ATTCTGGCTCCTTGGAGAGAAGG + Intronic
935921794 2:108023486-108023508 AGGCTGTTCCCTTGGTGAGGAGG - Intergenic
936481620 2:112890274-112890296 AAGATGGGTCCTTGCAGAGAAGG - Intergenic
937821853 2:126319114-126319136 AGGGAGTGCCCTTGGGGAGAAGG - Intergenic
942127652 2:172843313-172843335 AGGCTCTATCCTTAAAGAGATGG + Intronic
942794300 2:179798291-179798313 ATGGGGTGTCCTTGGAGAAATGG - Intronic
942905023 2:181169773-181169795 AGGCTGACTGCTGGGAGAGAAGG - Intergenic
946159404 2:217826906-217826928 AGGCTCTTTGCTTGGAGAGAAGG + Intronic
946372305 2:219288252-219288274 AGGAGGTGTCCTTGGACAAATGG - Intergenic
946407269 2:219498356-219498378 AGGCTGTGACCTTGGCGTGGGGG - Intergenic
947420458 2:229937715-229937737 AGGGTGTGGCCTTGGTAAGAAGG - Intronic
947941215 2:234057289-234057311 ACACTGTGACTTTGGAGAGATGG - Intronic
948373021 2:237502650-237502672 AGGCTGTGTCCTTTAAAACAGGG - Intronic
1169191245 20:3660341-3660363 AGACTGGCTCCTTGGACAGAAGG + Intronic
1169279074 20:4251842-4251864 AGGCAGAGACCTTGGAGAGAAGG - Intergenic
1170099145 20:12679295-12679317 AGGGTGTGGCTGTGGAGAGAAGG + Intergenic
1170143854 20:13151824-13151846 GGGCTGTGTCCAAGGAGTGAAGG - Intronic
1170868748 20:20185001-20185023 AGGCTGTGGTCATGGAGAGTTGG + Intronic
1172127211 20:32631871-32631893 TGGCTCTGGCCTTGGGGAGAGGG - Intergenic
1172525821 20:35600252-35600274 AGGCTGTTCCCTGGGAGAGTAGG - Intergenic
1172539331 20:35699059-35699081 GGGATGTGTCATTTGAGAGAAGG + Intronic
1172763449 20:37337704-37337726 AGTCTGTGTCCCTGGAGACCTGG + Intergenic
1174131012 20:48343283-48343305 CGGCCGTGGCCTTGGAGACAGGG + Intergenic
1174420155 20:50394183-50394205 AGCCCGTGTGCTTGGAGAGGTGG + Intergenic
1174726794 20:52871292-52871314 AGGCTGAGTCCTGGAAGACAGGG - Intergenic
1175453607 20:59092373-59092395 AGCCTGGGTCCTTGGAAACAGGG - Intergenic
1175720668 20:61284987-61285009 GGGCTGTGTCCTTACAGAGCAGG - Intronic
1175992828 20:62797892-62797914 AGGTGGTGTACTTGGAGAGTGGG + Intronic
1176282764 20:64324079-64324101 TGCCTGTGGCCTTGGAGACATGG + Intergenic
1176338676 21:5622613-5622635 AGGCTGTGACCTTGTAGGTATGG - Intergenic
1176340084 21:5685686-5685708 AGGCTGTGACCTTGTAGGTATGG - Intergenic
1176472338 21:7117839-7117861 AGGCTGTGACCTTGTAGGTATGG - Intergenic
1176495899 21:7499617-7499639 AGGCTGTGACCTTGTAGGTATGG - Intergenic
1176504743 21:7638770-7638792 AGGCTGTGACCTTGTAGGTATGG + Intergenic
1179287402 21:39989698-39989720 GGACAGGGTCCTTGGAGAGATGG - Intergenic
1179588761 21:42391095-42391117 AGGCTGTTTCCCTGCAGAGGAGG + Intronic
1180048896 21:45322373-45322395 AGGCTGGCTCCTGGGACAGAGGG + Intergenic
1180869199 22:19136978-19137000 AGGCTGTGTGCTTGTAGAGAAGG - Intronic
1180962498 22:19768279-19768301 TGGCTGTGCCCTCGGAGAGGTGG - Intronic
1181045271 22:20211340-20211362 AGGCTGTGTCCCAGGAGGCATGG - Intergenic
1183273355 22:36875783-36875805 AGTCTGTGGCCTGGGAGGGAGGG + Exonic
1183963886 22:41429620-41429642 AGGCTAGGCCCCTGGAGAGAAGG + Intergenic
1184247016 22:43240917-43240939 AGGCTCAGGCCTTGGAGAGATGG + Intronic
1184740323 22:46424562-46424584 AGGCAGGGTCCTTGTAGTGATGG - Intronic
949141081 3:633954-633976 AGGATGTGTTCTTGGAGGAAAGG + Intergenic
949215985 3:1567946-1567968 ATGCTGTGCTCTGGGAGAGATGG - Intergenic
950846631 3:16021741-16021763 AGGCTGGGTCCTTTAAGAGAGGG + Intergenic
952048282 3:29350599-29350621 AAGCTTTGTCCCAGGAGAGAGGG - Intronic
952508677 3:34032707-34032729 ATTCTGTGTCCTGTGAGAGACGG + Intergenic
957170694 3:76733184-76733206 AGGCTGTGTCCCTGCCCAGAAGG + Intronic
957346186 3:78964174-78964196 TGGCTGTGTCCTTATAGAAAGGG - Intronic
958997294 3:100919069-100919091 TGGCAGAGTCCTTAGAGAGACGG - Intronic
961755824 3:129126882-129126904 AGGCAGTGTCCGTGGAGGGCTGG - Intronic
962062353 3:131943571-131943593 TGGCTGTGGCACTGGAGAGAAGG - Intronic
962575829 3:136753895-136753917 AGGGAGTGGCTTTGGAGAGAAGG - Intergenic
962934550 3:140067727-140067749 GGGATGTTTCCTGGGAGAGACGG + Intronic
964044658 3:152308602-152308624 AGGCTGAGTCCTTAGAAACATGG - Intronic
965080384 3:164024782-164024804 AAGCTGGGTCGTTGGAGAAAGGG + Intergenic
965711430 3:171559773-171559795 AGGCTTTGATCTTGGAGATAAGG + Intergenic
966775862 3:183542105-183542127 AGGCAGTGTGGTTGGGGAGAAGG - Intronic
967017786 3:185497381-185497403 AGGCAGTGTCCTTGAAAGGAAGG - Intronic
968392735 4:205998-206020 AGGCTGTGGCCGTGAAGGGAGGG + Intergenic
968578006 4:1376869-1376891 AGGCTGTGTCCTGGGATGGAAGG + Intronic
968882432 4:3308305-3308327 AGGCTGTGTCCTCGACGCGAGGG + Intronic
969265990 4:6064379-6064401 AGGCGGTGACCTTGGGGTGATGG + Intronic
969462380 4:7335639-7335661 GGGCTGTGTGCGTGGAGGGATGG - Intronic
973631763 4:52826345-52826367 AGGCAGTGTGGGTGGAGAGAAGG - Intergenic
979111280 4:116761235-116761257 AGGCAGTGCCCATGGAGGGAGGG + Intergenic
980693308 4:136323700-136323722 AGGATGTGTGTGTGGAGAGAGGG + Intergenic
980908463 4:138972225-138972247 ATGCTGTGCCCTTGGAAACATGG - Intergenic
983541912 4:168920171-168920193 AGGCAGTGTACATGGAGAGCTGG + Intronic
984975824 4:185229266-185229288 AAGCTGAGAGCTTGGAGAGAAGG + Intronic
985863435 5:2492821-2492843 AGGCTCTGTCTTTGCAGGGATGG - Intergenic
986239942 5:5951844-5951866 ACGGTGTGTCCCTGGGGAGAGGG + Intergenic
987018642 5:13847104-13847126 AGACTGTGTCCGTGAAGATAAGG - Intronic
988909663 5:35826621-35826643 AGGTTGGGTCCTGGGACAGAAGG - Intergenic
989639606 5:43570134-43570156 AGGATGTGTCCTGGGAGATAAGG - Intergenic
991175943 5:63687816-63687838 GGGCTGTGTCCTTTAAGTGAGGG + Intergenic
992024311 5:72655595-72655617 TGGCTGAGCCCTTGCAGAGACGG + Intergenic
992252528 5:74889582-74889604 AGACTGTGACCATGCAGAGAGGG + Intergenic
994580847 5:101639686-101639708 AGGCAGTGGCCAGGGAGAGAAGG - Intergenic
995418570 5:111936937-111936959 ACTCTGTGTCCTTGGACAGTGGG + Intronic
995998778 5:118332887-118332909 AGGGTGTGTCCTGGGATACATGG + Intergenic
998963554 5:147512790-147512812 AGTCTGTTTACTTTGAGAGAGGG + Intergenic
1001412182 5:171519658-171519680 AGCCTGTGTCCTGAGAGAGCAGG + Intergenic
1001574640 5:172755231-172755253 AGGGAGTGTCCTTAAAGAGAGGG - Intergenic
1003122498 6:3329636-3329658 AGCCTGTGTCCTTGCAGCCAAGG + Intronic
1004950143 6:20660443-20660465 AGGCTGTGTATTTGTAGAAAGGG + Intronic
1006023157 6:31129720-31129742 AGGCTGGGTACTAGGAGAGAAGG + Intronic
1006638850 6:35478547-35478569 GGGCTTTGTCCTTGGAGACCTGG + Exonic
1007321070 6:41028977-41028999 ATGTTGTGGCCTAGGAGAGAGGG - Intronic
1007418418 6:41705528-41705550 AAGCTGTGTCGTTGGGAAGAGGG - Intronic
1007585509 6:42986585-42986607 AGGCCCTGTCCTTGGGGAGTGGG + Intronic
1007636018 6:43300321-43300343 AGGCTGGCCCCTTGGAGAGTTGG + Intronic
1007809785 6:44477592-44477614 AGGCTGTGCCCATCCAGAGAGGG - Intergenic
1007912414 6:45529181-45529203 AAGCTGTGTCCATGGAGAAATGG - Intronic
1009317974 6:62247033-62247055 AAACTGTCTCCTGGGAGAGAAGG + Intronic
1012858184 6:104527868-104527890 AGGCTGTGTTATAGGAGAGATGG + Intergenic
1016504399 6:144762461-144762483 GGGCTTTGTCCTTGGACAGCTGG - Intronic
1016538484 6:145136078-145136100 AGTCTGTGTCCTTGTAGTGGGGG + Intergenic
1017756043 6:157530422-157530444 ATGCTGTGTCCCTTTAGAGAAGG + Intronic
1019018403 6:168897196-168897218 AGGCTCTGTCTTTGGACAGCAGG + Intergenic
1019592510 7:1842765-1842787 AGGCTGTGTCCTGGAGGGGAGGG + Intronic
1019628334 7:2032785-2032807 AGGCTGAGTTCTGGGAGAGCAGG - Intronic
1019989445 7:4681925-4681947 AGCCTGGGTCATTGGAGAAAGGG - Intergenic
1020799250 7:12713769-12713791 ACTCTGTGTCCTTGGAGATAAGG + Intergenic
1022306230 7:29149015-29149037 ATGCTGTGCTCTTGGACAGATGG + Intronic
1022967624 7:35488006-35488028 AGGCTCCCTCCTTGGAGAGAAGG + Intergenic
1023619475 7:42055339-42055361 AGGCTGTGGCCTTGGGGAGGAGG - Intronic
1023947041 7:44811382-44811404 AGGCTCTCTTCTTGGAAAGAGGG - Intronic
1025195175 7:56926985-56927007 AGACTGTGTTCTTAGAGCGATGG - Intergenic
1025250820 7:57350309-57350331 AGCCCGTGTGCTTGGAGAGGTGG - Intergenic
1025286605 7:57667464-57667486 AGCGTGTGTCCTAGAAGAGAGGG - Intergenic
1025676777 7:63649958-63649980 AGACTGTGTTCTTAGAGCGATGG + Intergenic
1026443992 7:70468289-70468311 AGGCTTTGTCCTTTGATGGAAGG + Intronic
1026692487 7:72561391-72561413 TGATTGTGTCATTGGAGAGATGG - Intronic
1029632917 7:101764362-101764384 AGGCTGTGTCGTAGGGGAGGGGG - Intergenic
1029635968 7:101783984-101784006 AGGCTGTGACGTTGGAATGAAGG + Intergenic
1029799662 7:102933339-102933361 AGGCTGTGTTCTTTTAAAGAAGG + Intronic
1031758620 7:125681565-125681587 AGAATGTGTTCTTTGAGAGAGGG + Intergenic
1031968248 7:128044022-128044044 AGGCTGTGTCTGGGGACAGAAGG + Intronic
1032541355 7:132705682-132705704 AGGCTGTGTCCTTGGAGAGAAGG - Intronic
1032642247 7:133782766-133782788 ATGCTGTGCACGTGGAGAGAGGG + Intronic
1032851426 7:135798891-135798913 AGTATGTTTCCTTGCAGAGAGGG + Intergenic
1032953950 7:136949083-136949105 AGGCGGTGTCCTTGGATAGATGG + Intronic
1033151487 7:138918597-138918619 GGGGTATGTTCTTGGAGAGATGG + Exonic
1033336359 7:140455947-140455969 AGGGTGTGTCCTTGAAGAGTGGG - Intronic
1035621258 8:1037073-1037095 ATGCTGTGTCCCTGGAGAGTGGG + Intergenic
1036762148 8:11516821-11516843 AGCCAGTGTCCATGGACAGATGG - Intronic
1037947179 8:22996858-22996880 AGGATCTGGCATTGGAGAGATGG + Intronic
1038627550 8:29208840-29208862 AGGCTGTGGCCTGGGGGAGCTGG - Intronic
1039130224 8:34255646-34255668 AGTATGTGTCCTGGAAGAGACGG + Intergenic
1040777026 8:51057620-51057642 AGGCTGCTTCCTGGGAGACAGGG - Intergenic
1041153605 8:54961361-54961383 AGGCTGTGTCCCTAGGGAAAGGG - Intergenic
1041546293 8:59047054-59047076 AGAATGTGTCCATGGAGAAAGGG + Intronic
1044899387 8:96927665-96927687 ATGCTGTCTCATTGGAGGGAAGG + Intronic
1044931955 8:97259781-97259803 AGGCTGTGTGCTGGGGGAGTGGG - Intergenic
1045652105 8:104350955-104350977 TGGCTTTGTTCTTGGAGTGAGGG - Intronic
1047390146 8:124443900-124443922 AGGATATGTCCTGGGAGATAAGG + Intergenic
1047837076 8:128705711-128705733 AGGCTCTGTCTTTAGAGGGAGGG - Intergenic
1048212668 8:132468381-132468403 ATGGTGTCTTCTTGGAGAGATGG - Intronic
1048282550 8:133115783-133115805 AGGCTATGTGCTTAGAGAGGCGG - Intronic
1048890911 8:138945625-138945647 AGGGTGTATCATTGGAGAGAAGG + Intergenic
1049198224 8:141326943-141326965 TGACTGTGTCCTTGGAAAAAGGG + Intergenic
1050260962 9:3840693-3840715 TCCCTTTGTCCTTGGAGAGATGG + Intronic
1053294894 9:36905727-36905749 AGCCTTTGTCCTTGCAGAGTGGG - Intronic
1053439787 9:38106854-38106876 AGGCTGGCTCCTGAGAGAGAAGG + Intergenic
1054352039 9:64026172-64026194 ATGATGAGTCCTTGGAGAGCAGG + Intergenic
1055555404 9:77468343-77468365 TGGCTGTTTCACTGGAGAGAGGG + Intronic
1055559695 9:77510670-77510692 AGGCTTGCTCCTTGGTGAGATGG - Intronic
1056520326 9:87395299-87395321 TGGCTGTCTTCTTGGAGAAATGG - Intergenic
1058126826 9:101204887-101204909 AGGTTCTATCTTTGGAGAGAAGG + Intronic
1058627147 9:106946628-106946650 AGGGTATGTCCTCGGAAAGATGG + Intronic
1058639164 9:107066293-107066315 AGGTTGTTTGCTTGGAGGGAAGG - Intergenic
1059340897 9:113597055-113597077 AGGCTGTGTCTCTGGACAGACGG + Exonic
1059601818 9:115786896-115786918 AGGTTATGTCCCTGGAGGGAGGG - Intergenic
1060812945 9:126620097-126620119 GGTGTGTGTCCTTGGAGACAAGG - Intronic
1062234847 9:135502865-135502887 AGGCTGTGACCTTGGCAAGATGG + Intronic
1203422983 Un_GL000195v1:12307-12329 AGGCTGTGACCTTGTAGGTATGG + Intergenic
1187046933 X:15656068-15656090 AGGGTGTGGGCTTGCAGAGAGGG - Intronic
1188582293 X:31728827-31728849 AGTGTGTGTCCCTGGAGGGAAGG + Intronic
1188651340 X:32634575-32634597 AGCCTGTCACCTTGAAGAGAAGG - Intronic
1189214633 X:39312352-39312374 AGGCTCTGACTCTGGAGAGATGG + Intergenic
1189268280 X:39732937-39732959 AGGCTGTCTCCTTGTAGATGGGG + Intergenic
1190618479 X:52262392-52262414 ATGCTGGGACATTGGAGAGAGGG - Intergenic
1192369053 X:70498428-70498450 AGGCTGTGTCCTGGCAGGGGAGG + Intronic
1196242376 X:113357358-113357380 AGGCTCTATTCTTGAAGAGAAGG + Intergenic
1198233065 X:134711797-134711819 AGGCCCTCTCCTTAGAGAGAGGG - Intronic
1199254528 X:145703753-145703775 AGTCTGTGTCCTTGGATTGCAGG + Intergenic
1200020921 X:153206912-153206934 AGGCTGTCAACCTGGAGAGATGG - Intergenic
1201687472 Y:16722806-16722828 AGGTGGTGTCACTGGAGAGAAGG + Intergenic