ID: 1032541359

View in Genome Browser
Species Human (GRCh38)
Location 7:132705702-132705724
Sequence CCTTATATGCAGAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032541353_1032541359 14 Left 1032541353 7:132705665-132705687 CCTGGGGTGATCACATTCCTTCT 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG No data
1032541352_1032541359 19 Left 1032541352 7:132705660-132705682 CCAGACCTGGGGTGATCACATTC 0: 1
1: 0
2: 0
3: 12
4: 232
Right 1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG No data
1032541355_1032541359 -3 Left 1032541355 7:132705682-132705704 CCTTCTCTCCAAGGACACAGCCT 0: 1
1: 0
2: 3
3: 35
4: 337
Right 1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032541359 Original CRISPR CCTTATATGCAGAAGGAAAC AGG Intronic
No off target data available for this crispr