ID: 1032541964

View in Genome Browser
Species Human (GRCh38)
Location 7:132710750-132710772
Sequence TGGGTTTCTCTAGGAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 207}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032541964_1032541966 -5 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541966 7:132710768-132710790 ACCCATAGCAACATTCTTGATGG No data
1032541964_1032541978 28 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541978 7:132710801-132710823 GTGGACTGGGGGGGTCCCCATGG No data
1032541964_1032541970 9 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541970 7:132710782-132710804 TCTTGATGGTCAGTGGTCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 73
1032541964_1032541969 2 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541969 7:132710775-132710797 GCAACATTCTTGATGGTCAGTGG No data
1032541964_1032541976 19 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541976 7:132710792-132710814 CAGTGGTCCGTGGACTGGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 162
1032541964_1032541972 15 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541972 7:132710788-132710810 TGGTCAGTGGTCCGTGGACTGGG 0: 1
1: 0
2: 0
3: 19
4: 132
1032541964_1032541974 17 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541974 7:132710790-132710812 GTCAGTGGTCCGTGGACTGGGGG No data
1032541964_1032541975 18 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541975 7:132710791-132710813 TCAGTGGTCCGTGGACTGGGGGG No data
1032541964_1032541971 14 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541971 7:132710787-132710809 ATGGTCAGTGGTCCGTGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 104
1032541964_1032541973 16 Left 1032541964 7:132710750-132710772 CCAGTTCTTCCTAGAGAAACCCA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1032541973 7:132710789-132710811 GGTCAGTGGTCCGTGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032541964 Original CRISPR TGGGTTTCTCTAGGAAGAAC TGG (reversed) Intronic
903975073 1:27144355-27144377 GGGGTCTCTCTGGGAAGATCTGG - Intronic
904307738 1:29601075-29601097 GAGCTTTCTCTAGGAAGACCTGG - Intergenic
904522722 1:31108211-31108233 TGCGTTTCTCTGGGTGGAACAGG + Intergenic
907190732 1:52645810-52645832 TAGGTTAATTTAGGAAGAACTGG - Intronic
908590582 1:65628406-65628428 TGGGTTCCTCCAGGAAGAGGAGG - Intronic
909854004 1:80505337-80505359 TGGTTTACTCAAGAAAGAACAGG - Intergenic
910497644 1:87850414-87850436 TAGGTTTATCTAGGAGGTACTGG - Intergenic
910569082 1:88680325-88680347 GGGGTTTCTTAAGGAAGAAGAGG + Intergenic
911059306 1:93733975-93733997 TGGATTTCTATAGGGAGAACTGG + Intronic
911789423 1:101993589-101993611 TGAGTTTTTCTAAAAAGAACTGG + Intronic
912521807 1:110250795-110250817 TGGGCTTCTCTAGGAGGAGGAGG + Intronic
915062625 1:153198813-153198835 TGGGATTCTCTATGCAGAGCTGG + Intergenic
915475811 1:156152267-156152289 TGGATGTCTGGAGGAAGAACTGG + Intronic
919497962 1:198300453-198300475 TGAGTTTCTTTGGAAAGAACAGG - Intronic
921545821 1:216473787-216473809 TGTGCTTCTCTGGGAAGAAAAGG - Intergenic
923884717 1:238141637-238141659 TGGGATTCTCTAGCAAGGAAGGG + Intergenic
924567731 1:245212111-245212133 TGGGATGCTCTAGGCAGAAGTGG + Intronic
1063152658 10:3350934-3350956 TGAATTTGTGTAGGAAGAACCGG - Intergenic
1063446301 10:6120002-6120024 TGGGATTCTCTGAGAAGAATGGG - Intergenic
1064256082 10:13743768-13743790 TGGGCTTATCCTGGAAGAACAGG + Intronic
1064869669 10:19923674-19923696 TTGGTTTTTCTAGCAAAAACAGG + Intronic
1067858140 10:49815473-49815495 TGTGCTTCTCTGAGAAGAACAGG - Intergenic
1068093956 10:52466890-52466912 TCCGTTTCTCTAGTTAGAACTGG - Intergenic
1068598897 10:58934987-58935009 TAGGTTTTTTTAGGATGAACAGG - Intergenic
1070248691 10:74754633-74754655 GGGCTTTTTCTTGGAAGAACTGG - Intergenic
1073363122 10:102916587-102916609 TGGCTTTCTCTAGGATGAGATGG + Intergenic
1074015345 10:109528745-109528767 TTGCTTTTTCTACGAAGAACTGG - Intergenic
1074920442 10:118003267-118003289 TCAGTTTCTCTAGAAAGATCAGG + Intergenic
1075553717 10:123413642-123413664 TAGGTTCCTCTGCGAAGAACTGG - Intergenic
1077707131 11:4497574-4497596 TGGGTCTCTCTCGGAAAATCAGG - Intergenic
1077982668 11:7316278-7316300 TGGTTTTCTCTTGGCAGGACTGG - Intronic
1078774859 11:14384500-14384522 TGAGTTCCTTTGGGAAGAACTGG - Intergenic
1080140441 11:28912186-28912208 TGGTTTTATCTAGAAAGAAAAGG - Intergenic
1081961043 11:47137773-47137795 CAGGTTTCTCTAGGAAGCAGTGG - Intronic
1085196131 11:74672921-74672943 TGGGTTTCTCTGGGCAGCACAGG - Intergenic
1088471669 11:110193956-110193978 TGGGTTTTTCTAGCCAGGACTGG - Intronic
1088649813 11:111947539-111947561 TGGGCATTTATAGGAAGAACAGG + Intronic
1089006970 11:115100328-115100350 TGGGGTTATCTATGAAGAATGGG + Intergenic
1090379988 11:126319658-126319680 TACGTGTCTCTAGGAAGAATTGG + Intronic
1092132900 12:6124855-6124877 TGGGGCACTCTAGGAAGACCAGG - Intergenic
1092214810 12:6673503-6673525 TGGGCTTCTCTTGGAAGTAGAGG - Intronic
1093822082 12:23633108-23633130 TGGCTTCCTATAGGTAGAACAGG + Intronic
1095507408 12:42911961-42911983 TGGGGTTCTCTATAGAGAACTGG - Intergenic
1097720626 12:63016545-63016567 TGGGTATCTAGAGGAAGAAAAGG + Intergenic
1098832807 12:75383266-75383288 TTGGTTTCTGTAGAAAGAAGTGG - Intronic
1100034078 12:90229722-90229744 TGGGCTACTTTAGAAAGAACGGG - Intergenic
1100953175 12:99876015-99876037 TGGATTCCTCTTGGAAAAACTGG - Intronic
1102744210 12:115235528-115235550 TAGATTTCTCAAGGCAGAACGGG + Intergenic
1102911364 12:116716873-116716895 TGGGTTTCTATTGATAGAACAGG + Exonic
1104249682 12:127079763-127079785 TGGGTGTCTTTAGGATTAACAGG + Intergenic
1106106321 13:26736612-26736634 TGGGTTCTTTTAGGAAGAATAGG - Intergenic
1108012885 13:46038623-46038645 TGAATTTCTCTAGGAAGATCAGG - Intronic
1108116329 13:47132627-47132649 TGGGTTTCTCTGAGAAAAGCAGG - Intergenic
1109088639 13:58010095-58010117 TGTGTGTGTCTAGGAATAACTGG - Intergenic
1111764342 13:92508915-92508937 TGCATTTCTCTATGAAGGACTGG + Intronic
1111816692 13:93162806-93162828 TGGGTTTTTATCTGAAGAACAGG - Intergenic
1112380651 13:98886041-98886063 ATGGTATTTCTAGGAAGAACTGG + Intronic
1112658645 13:101481386-101481408 TGGGTGGCTATAGGAAGAAAAGG + Intronic
1113873432 13:113579107-113579129 TAGGTTTCTGTATGAAGGACTGG + Intergenic
1113911513 13:113843510-113843532 TGGGTTTCCCCAGGAAGGTCAGG - Intronic
1114401901 14:22417881-22417903 TGAGAATCTCCAGGAAGAACTGG - Intergenic
1115392125 14:32865921-32865943 TGTGTTTTTCCAGGAAGCACAGG - Intergenic
1119932713 14:78563808-78563830 TGGGGTTCTAAAGGAAGAGCAGG + Intronic
1120108366 14:80522765-80522787 TGGGTTTCTGTAGGACATACAGG - Intronic
1120254436 14:82100948-82100970 TTGGTTTCTGTAGGGAGAAATGG + Intergenic
1122664814 14:103321523-103321545 TGGGCTGCTTTAGGAAGAGCTGG - Intergenic
1123150447 14:106176446-106176468 TAGGTTTCCATTGGAAGAACAGG - Intergenic
1124400072 15:29340308-29340330 TGGGTTTTTGCAGGAAGAATAGG + Intronic
1126710769 15:51453277-51453299 TTAGTTTCTCTAGGACTAACAGG - Intronic
1128764079 15:70240372-70240394 TTAGTTTCTCCAGGAAGAACAGG - Intergenic
1129048543 15:72758393-72758415 TGGGCTTCTCTGGGGAGATCTGG + Intronic
1129127560 15:73457228-73457250 TTGTTTTCTCTACTAAGAACAGG + Intronic
1130202064 15:81841296-81841318 TGTGTTTGTCTAAGAAGAAGCGG + Intergenic
1130953393 15:88610143-88610165 TAGGTATTTCTAGGAAAAACAGG - Intergenic
1134354816 16:13471910-13471932 TGAGTTACACTAAGAAGAACAGG - Intergenic
1134786702 16:16951308-16951330 TGGGTTTCTATTGACAGAACAGG + Intergenic
1135499220 16:22979243-22979265 TGGGTTTTTCTGGGCAGGACAGG - Intergenic
1136229653 16:28878878-28878900 AGGGTTTCTTAAGGAAGAGCTGG + Intronic
1136679606 16:31950341-31950363 TAGGTTTCCATTGGAAGAACAGG + Intergenic
1136780158 16:32893767-32893789 TAGGTTTCCATTGGAAGAACAGG + Intergenic
1136890449 16:33967760-33967782 TAGGTTTCCATTGGAAGAACAGG - Intergenic
1138564985 16:57826550-57826572 TTTGTTTCTCGAGAAAGAACTGG - Intronic
1138767114 16:59617797-59617819 TTGGTTTCTGCAGGAAGAAATGG + Intergenic
1141553356 16:84820795-84820817 TGGGTTTCTTTAGCCAGAGCGGG + Intronic
1141560928 16:84867339-84867361 TGGGTTCCTCTGGGAAGCGCTGG + Intronic
1203082580 16_KI270728v1_random:1155854-1155876 TAGGTTTCCATTGGAAGAACAGG + Intergenic
1143920636 17:10328577-10328599 TGGGTTTCTCCAGCAGGAAGAGG - Intronic
1147145738 17:38483480-38483502 AGGGTTGCTCTAGCAAGGACAGG - Intronic
1147276193 17:39318811-39318833 TGGGTTTATTTAAGAAGAAGAGG - Intronic
1149564141 17:57629655-57629677 TGGGTGTCTCCAGGAAGGAGTGG - Intronic
1151247369 17:72805224-72805246 GGGGTTTCTCAAGGAAAAGCAGG - Intronic
1155337204 18:24776832-24776854 TGTGGCTCTCTAGGTAGAACAGG - Intergenic
1157385790 18:47259406-47259428 TTGGCTTCTCTAGGAAACACTGG - Intergenic
1157611163 18:48956688-48956710 TTGGCTTCTCTTGGAAGAACAGG + Intergenic
1159165288 18:64691234-64691256 TGTGGTTCTCAGGGAAGAACTGG + Intergenic
1163142321 19:15358157-15358179 TGGGTTTCACAAGGAAGAACTGG + Intronic
1164114966 19:22210994-22211016 TTGTTTTCTCTAGGAAAAAAAGG + Intergenic
1165449192 19:35872411-35872433 TGTGGTTCTCTAGGTAGAAAAGG + Intronic
1165668180 19:37652260-37652282 TGGTTTTCTCTCTGAAGAACAGG - Intronic
1166754251 19:45180609-45180631 TGGGTTCTTGTGGGAAGAACGGG - Exonic
929593984 2:43164430-43164452 TCGGTTTCTTTAGGCAGAGCAGG - Intergenic
929919116 2:46160076-46160098 AAGGTTTCTTTATGAAGAACTGG + Intronic
932059851 2:68485300-68485322 TGGGACACTCTAGGAATAACTGG - Intronic
934563013 2:95322985-95323007 TGGGATTCTCAAGGAAGAATGGG + Intronic
936454921 2:112665706-112665728 TGTGTTTCTGTAGGCAGAGCAGG + Intergenic
939423206 2:142000768-142000790 TAGTTTTCTCTATGTAGAACAGG - Intronic
940039231 2:149342502-149342524 TGGTTTACTCTAGGAAGATAAGG - Intronic
941147914 2:161875879-161875901 AGGGATTCTCTGGGAAGAAATGG - Intronic
942698000 2:178668028-178668050 TGGATTTGTCTATAAAGAACAGG + Intronic
944908337 2:204285108-204285130 TGGATTTCCCTAGGCAGAGCTGG - Intergenic
947184975 2:227446546-227446568 AGGGTATGTCTAGGAAGAACAGG + Intergenic
947948598 2:234127911-234127933 TGGGTTTCTGAAGGAAAAGCAGG - Intergenic
1169289341 20:4335325-4335347 TGGGTTTGTTTTGGAAAAACAGG - Intergenic
1174885413 20:54328723-54328745 TGGGTTTCTCAAGCCTGAACAGG - Intergenic
1175989867 20:62783121-62783143 TGGGAGGCTCCAGGAAGAACTGG - Intergenic
1177434141 21:21028415-21028437 TGGTTTTCTCTCGAAAGAGCTGG - Intronic
1178343466 21:31805553-31805575 TGAGTTTCTAGAGGAAGAAAAGG - Intergenic
1178602798 21:34009481-34009503 TGGGCATGTCTGGGAAGAACTGG + Intergenic
1181111617 22:20605975-20605997 TGGGTTTCTCATGGAAGCAGTGG - Intergenic
1181997480 22:26894081-26894103 TGGGTTTTACTGGAAAGAACAGG - Intergenic
1184266573 22:43350131-43350153 TGGGATTCTCTAGGTGGAGCTGG + Intergenic
1184317716 22:43710003-43710025 GGGGTTTCTCTAGAAAGGAGAGG - Intronic
950237174 3:11333473-11333495 TGGTTTACTATATGAAGAACAGG - Intronic
953033784 3:39193985-39194007 TGGCTCTCTCTAGGAAGGGCAGG + Intergenic
954680448 3:52343195-52343217 TGTGTTTCTTTATGAAAAACTGG - Intronic
956983257 3:74665532-74665554 TAGGTTTCACTATGAAGCACAGG - Intergenic
958667119 3:97155624-97155646 TGGGTTTTACTAGGAAGCTCTGG + Intronic
960947884 3:122979300-122979322 TTGGTGTCTCCAGGAAGAAATGG + Intronic
961577331 3:127848553-127848575 TGAGTTTCTGTAGGAGGAATGGG + Intergenic
963928220 3:150974287-150974309 TGGGTTCGTCTAGGAGTAACAGG + Intergenic
967880936 3:194300714-194300736 CGGGCTGCTCTTGGAAGAACTGG + Intergenic
968067900 3:195769012-195769034 TGGGCTTCTCTAGGTAGGATGGG - Exonic
969318563 4:6396492-6396514 TTGGTGTCTCCAGGAAAAACTGG - Intronic
969339748 4:6532706-6532728 TGGGTTAATTTGGGAAGAACAGG - Intronic
970422109 4:15914943-15914965 TTGGTTTCTGCAGGAAGAAATGG + Intergenic
972905397 4:43740248-43740270 TGCTTTTCTCTAGACAGAACAGG - Intergenic
973827895 4:54727400-54727422 TGGGTTTCTGTGGGGAGAAAGGG - Exonic
975056844 4:69944024-69944046 TCGGTCTCTCTATTAAGAACAGG + Intronic
976778475 4:88732189-88732211 TGTGTATCTCCAGGAAGAAGAGG - Exonic
978272602 4:106908765-106908787 TGTGTTTCTCTATGAACAGCAGG - Intergenic
979509755 4:121538902-121538924 TGGGTTTCTGTTGGAAAAACAGG - Intergenic
979903676 4:126256082-126256104 TTGGTTTCTGTAGGTAGATCAGG + Intergenic
981457321 4:144968260-144968282 TGAATTTCTCTAAGAAGGACGGG + Intronic
982017809 4:151172799-151172821 TGGGTTTCTCCAGGAAAGGCTGG + Intronic
983381210 4:166996688-166996710 TGGCTTTTTCTGTGAAGAACTGG - Intronic
984847785 4:184122356-184122378 TGGGTTCCACCAGGAAGAAAGGG - Intronic
985868603 5:2536274-2536296 TGGGTCTCACTGGGAAGAAGGGG + Intergenic
986150092 5:5120423-5120445 TGTGTTTCCCTAGAAAGAACCGG - Intergenic
989752332 5:44910947-44910969 TGGGTTTCTTTCTGAAGAATAGG - Intergenic
992348597 5:75906502-75906524 TGGGTTTCTAGAAGAAAAACTGG + Intergenic
992408308 5:76480428-76480450 TGGGTTCATCTATGAAGACCAGG - Intronic
993626110 5:90226784-90226806 TGGGTTTCTCTAAAAAGAGATGG - Intergenic
994103653 5:95921719-95921741 TTTGTTTCTCTGGGAAGAGCAGG + Intronic
995980991 5:118104122-118104144 AGGGTTTATCTATGAAGAAAGGG - Intergenic
996491729 5:124105860-124105882 TGGGAATCTCTTGAAAGAACCGG + Intergenic
996613081 5:125407598-125407620 TGTATTTCTCTTGGAAGCACTGG + Intergenic
997200331 5:132006153-132006175 AGGGTATCTCTGGGAAGAGCTGG + Intronic
1001762058 5:174215580-174215602 TGAGCTTCTCTCGGAAGCACAGG + Intronic
1002783425 6:383869-383891 TGGGCTTCTCTAGGCAGGGCAGG - Intergenic
1003772784 6:9325521-9325543 TGTTTTTCTCTAGAAAGAATGGG + Intergenic
1005013100 6:21354652-21354674 TGGGTGTCTCTGGGTATAACAGG + Intergenic
1005300385 6:24464814-24464836 TGGGTGTGGCTAGGAAGCACAGG - Intronic
1005881600 6:30066779-30066801 TGGGTTTCTCTAAAGAAAACGGG - Intronic
1007832243 6:44647454-44647476 TGTATTTCTCTAGGAAGAGGGGG - Intergenic
1008906507 6:56683125-56683147 TTGATTTCTGTAGGAAGAAGGGG + Intronic
1011962903 6:93113529-93113551 TGTGTATCTGTAGGAAGACCTGG - Intergenic
1012553557 6:100486151-100486173 TTGGTTTCTATGGGAAGAAAAGG - Intergenic
1014344889 6:120255757-120255779 TCTGTTTCTCTAGGGAGAATGGG - Intergenic
1015602680 6:134925943-134925965 TGGTATTTTCCAGGAAGAACAGG + Intronic
1017285023 6:152664355-152664377 TGGGATTTTCTAGGAACAGCAGG - Intergenic
1019037996 6:169078294-169078316 TGAGTTTCTCCAGGAGGACCAGG + Intergenic
1019207441 6:170374372-170374394 TCGGTGTATTTAGGAAGAACAGG + Intronic
1019431264 7:1000878-1000900 TGAGTTTCTCTGGGAGGAAAGGG + Intronic
1022465675 7:30652120-30652142 TTGGTTTCTTTTGGAAGAAATGG + Intronic
1022832597 7:34083532-34083554 TGGGTTTCTCAAGAAATAAATGG - Intronic
1023140765 7:37100228-37100250 TAGCTTTGTCTAGGAGGAACAGG - Intronic
1023542689 7:41283130-41283152 TGGGTATCTCAAGGGGGAACAGG + Intergenic
1025872713 7:65449714-65449736 TGGTTTTCTCTGTGAAGAAGTGG + Intergenic
1029916908 7:104219626-104219648 TGGGGTTCTAGAGGCAGAACTGG - Intergenic
1030625868 7:111845499-111845521 TGGGTTTCTCTTGCAAGTCCTGG - Intronic
1030844765 7:114395444-114395466 TGGGGTTTACTAGGAAGAATAGG + Intronic
1031956279 7:127945595-127945617 TGGGTGTCTCTCAGGAGAACTGG + Intronic
1031962573 7:128003302-128003324 TGGGTCACTGTAGCAAGAACAGG + Intronic
1032541964 7:132710750-132710772 TGGGTTTCTCTAGGAAGAACTGG - Intronic
1032635792 7:133707082-133707104 TGGTTTTCTTAAAGAAGAACAGG - Intronic
1033606435 7:142931433-142931455 TGGGTGTCTCAAGGCAAAACAGG + Intronic
1034158145 7:148972396-148972418 TGGGTTTGTCAAGACAGAACTGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037586484 8:20280206-20280228 TGGGCTACTCTAAGAAGATCAGG - Intronic
1039078216 8:33711388-33711410 TGAGCTGCTCCAGGAAGAACAGG - Intergenic
1040572576 8:48623765-48623787 TGGGCTTCTCTGCTAAGAACTGG + Intergenic
1042154262 8:65825307-65825329 TTTGTTTCTATAAGAAGAACTGG - Intronic
1044364677 8:91329921-91329943 AGGATTTCTCTAGAAGGAACAGG - Intronic
1046095586 8:109555897-109555919 TGGCTGTTTCTTGGAAGAACTGG - Intronic
1046107621 8:109684787-109684809 TGGGTTTATGTAGAAAGAAGAGG - Intronic
1047423066 8:124723305-124723327 TATGTTACTCTAGTAAGAACTGG + Intronic
1049494550 8:142923624-142923646 TGAGATTCCCGAGGAAGAACAGG - Intergenic
1053266929 9:36721921-36721943 TGGGTTTCCTTAGGAAGAATAGG + Intergenic
1054451758 9:65407044-65407066 TTGGATTCTCCAGGAAGCACTGG + Intergenic
1055284818 9:74717086-74717108 TGGGTTTTTCTGGGAAAAACTGG - Intergenic
1055353122 9:75410472-75410494 TGGATTCCTCAAGGAAAAACAGG - Intergenic
1058483306 9:105418604-105418626 TGGGGTCCTCTTGGAACAACAGG - Intronic
1061771386 9:132926079-132926101 TGGGTTGCTCTAGCAATAAGTGG - Intronic
1186053775 X:5627489-5627511 TGGGCTACCCTAGAAAGAACAGG + Intergenic
1187151460 X:16685407-16685429 TTGGTTGCTCTCGGAAGTACAGG - Intronic
1188829708 X:34881444-34881466 TGGGTTTCTTCAGGAAGGAATGG + Intergenic
1190203355 X:48382268-48382290 TGGGTTTCTCTATGTAGGCCAGG - Intergenic
1190207181 X:48413136-48413158 TGGGTTTCTCTATGTAGGCCAGG + Intergenic
1190823181 X:53993543-53993565 TGGGTGTCCCTTGGAAGAGCAGG - Intronic
1193997576 X:88385003-88385025 TGGGGCTCTGTAGGAAGAGCCGG - Intergenic
1194345692 X:92761717-92761739 TGAGTTTTTCTGAGAAGAACAGG + Intergenic
1196374403 X:115017391-115017413 TGTGCTTCTCTACCAAGAACTGG + Intronic
1197266632 X:124380958-124380980 TGGGTCTCTGGAGGAAGACCTGG - Exonic
1197897793 X:131334067-131334089 TGGGTTTCTCTGGGATGGCCAGG - Intronic
1198415673 X:136417398-136417420 TGGTTCTCTCTAGGAAGGAAAGG + Intergenic
1198453696 X:136794053-136794075 TCAGTTCCTTTAGGAAGAACTGG - Intergenic
1199942127 X:152637572-152637594 TGTGTTTTTCTTGGAAGAAAGGG - Intergenic
1200085599 X:153603080-153603102 GGGGTTTCACAAGGAAGAGCTGG + Intergenic
1200654038 Y:5878368-5878390 TGAGTTTTTCTGAGAAGAACAGG + Intergenic
1200707362 Y:6454271-6454293 AGGGTCTCTCTATGAAGCACAGG + Intergenic
1201026750 Y:9710437-9710459 AGGGTCTCTCTATGAAGCACAGG - Intergenic