ID: 1032546679

View in Genome Browser
Species Human (GRCh38)
Location 7:132749552-132749574
Sequence ATCAATTTGCAGATGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032546679_1032546683 24 Left 1032546679 7:132749552-132749574 CCTTGGCCCATCTGCAAATTGAT No data
Right 1032546683 7:132749599-132749621 AAGAAACTGATGTTTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032546679 Original CRISPR ATCAATTTGCAGATGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr