ID: 1032547304

View in Genome Browser
Species Human (GRCh38)
Location 7:132754660-132754682
Sequence GTGGGAGCCCATATAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032547304_1032547312 27 Left 1032547304 7:132754660-132754682 CCATCAACTATATGGGCTCCCAC No data
Right 1032547312 7:132754710-132754732 CAATATCATTAACCTCCCCAAGG No data
1032547304_1032547308 -3 Left 1032547304 7:132754660-132754682 CCATCAACTATATGGGCTCCCAC No data
Right 1032547308 7:132754680-132754702 CACATTCAAGGCACCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032547304 Original CRISPR GTGGGAGCCCATATAGTTGA TGG (reversed) Intergenic
No off target data available for this crispr