ID: 1032550617

View in Genome Browser
Species Human (GRCh38)
Location 7:132780903-132780925
Sequence GCAGAGCTCGCCCAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032550611_1032550617 13 Left 1032550611 7:132780867-132780889 CCTCCATCATGGATAAAGCAGTG No data
Right 1032550617 7:132780903-132780925 GCAGAGCTCGCCCAGGGAGATGG No data
1032550610_1032550617 23 Left 1032550610 7:132780857-132780879 CCAATCTGATCCTCCATCATGGA No data
Right 1032550617 7:132780903-132780925 GCAGAGCTCGCCCAGGGAGATGG No data
1032550612_1032550617 10 Left 1032550612 7:132780870-132780892 CCATCATGGATAAAGCAGTGCTA No data
Right 1032550617 7:132780903-132780925 GCAGAGCTCGCCCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032550617 Original CRISPR GCAGAGCTCGCCCAGGGAGA TGG Intergenic
No off target data available for this crispr