ID: 1032554484

View in Genome Browser
Species Human (GRCh38)
Location 7:132817445-132817467
Sequence CTATTCTCCTTAGGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032554484 Original CRISPR CTATTCTCCTTAGGGACAAA AGG Intronic
901203291 1:7478874-7478896 CTAATCTCCTTTGGAGCAAAGGG + Intronic
901298484 1:8180393-8180415 CCATTCTTCTTAAGGACACATGG - Intergenic
907729267 1:57050055-57050077 CTACTGTCCTTAGGGATAGAAGG - Intronic
910535316 1:88290988-88291010 CCATTCTCCACAGTGACAAAAGG - Intergenic
911174212 1:94803097-94803119 ATATTCTCCTTAGTTAGAAATGG + Intergenic
911542530 1:99175320-99175342 TTCTTCTTCTTAGGGACAGAAGG + Intergenic
911699102 1:100929900-100929922 CAACTCACCTTAGGGAAAAAAGG - Intronic
913595613 1:120373193-120373215 CTATCCTCCTTACTTACAAAGGG - Intergenic
914091661 1:144505782-144505804 CTATCCTCCTTACTTACAAAGGG + Intergenic
914306884 1:146428078-146428100 CTATCCTCCTTACTTACAAAGGG - Intergenic
914595166 1:149144720-149144742 CTATCCTCCTTACTTACAAAGGG + Intergenic
916197395 1:162237218-162237240 AAATTCTCATTAGAGACAAAGGG + Intronic
919301693 1:195777316-195777338 TTCTTCTCCATAGGGGCAAAAGG - Intergenic
921143196 1:212325543-212325565 CTATTAGCGTTAGGGAAAAAGGG + Intronic
921417115 1:214901587-214901609 CTATTATCCTTAGTTTCAAAGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922067519 1:222158509-222158531 TTATTCTCCCAAGGGACCAAGGG + Intergenic
922252563 1:223863407-223863429 CCATTCTCCTTAGAGAGAAGTGG + Intergenic
1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG + Intronic
1067262599 10:44707320-44707342 CTTTCCTCCTTAGGGTCTAACGG - Intergenic
1070181114 10:74015231-74015253 CTATTCTCCTGAGTAATAAAAGG + Intronic
1071980575 10:91000913-91000935 CTATTCTGAGTTGGGACAAAAGG - Intergenic
1073808460 10:107125948-107125970 AAAATCACCTTAGGGACAAAAGG - Intronic
1077292143 11:1802563-1802585 CCATTCTCCTTAGAGAGAAGTGG + Intergenic
1078434531 11:11313426-11313448 CTCTTCTCCTTAGGATCTAAAGG - Intronic
1079019908 11:16901224-16901246 ATATACTCCTTAGAGAAAAATGG + Intronic
1080080481 11:28212500-28212522 CACTTCTCCTCAGGTACAAAGGG - Intronic
1080308558 11:30863370-30863392 TTATTCTCCTGACAGACAAAAGG + Intronic
1083313737 11:61801323-61801345 CTTTTCTCCCTAGAAACAAAGGG - Exonic
1085964171 11:81500288-81500310 CAAATCCCCATAGGGACAAAGGG + Intergenic
1086185258 11:84005891-84005913 CTATTGTCCATAGTGGCAAATGG - Intronic
1086445946 11:86870440-86870462 CTATTCTCCTTTGGCAGAGATGG + Intronic
1088058403 11:105612116-105612138 GCATGCACCTTAGGGACAAAGGG + Intronic
1090204806 11:124878285-124878307 CTATTCTCCTCAGGAGCCAAGGG + Exonic
1090841744 11:130495486-130495508 CTATTATCGTTTGGAACAAATGG + Intergenic
1092283184 12:7112969-7112991 CTATGCTCTTTAGGGACACTTGG - Intergenic
1093649784 12:21629824-21629846 CTATTCTCTTTGGTGAAAAATGG + Intergenic
1093727839 12:22535454-22535476 CTATTATCCTCTGGGACAAAGGG + Intronic
1095552772 12:43462995-43463017 ATATTCTCCTGAGTAACAAAAGG + Exonic
1098563876 12:71908980-71909002 CCATTCTCCTTGGGAACAGAAGG + Intronic
1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG + Intergenic
1098971720 12:76864051-76864073 GCATTCTCCTTTGGGACAGAAGG - Intronic
1104526882 12:129532409-129532431 CTATTAATATTAGGGACAAAAGG + Intronic
1105480585 13:20772362-20772384 ATGTTCCCCTTAGCGACAAAAGG - Intronic
1107852670 13:44586844-44586866 CTGTTCTCCTTAGAAAAAAAAGG + Intergenic
1108557239 13:51605813-51605835 ATGTTCTCCTTGGGGACGAATGG + Intronic
1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG + Intergenic
1109132102 13:58600373-58600395 CTATTATCCTCAGCGACAAGTGG - Intergenic
1112951659 13:105005056-105005078 TTATTCTCCTAAGCAACAAAGGG + Intergenic
1114058780 14:19000302-19000324 CCATTCTCCTTAGAGAGAAGTGG - Intergenic
1114103764 14:19401452-19401474 CCATTCTCCTTAGAGAGAAGTGG + Intergenic
1115466222 14:33717268-33717290 CCAGTTTCCTCAGGGACAAAAGG + Intronic
1118002087 14:61532779-61532801 CGATTCTCCTTAGGCACCAGAGG - Intronic
1120412293 14:84173021-84173043 CTATTCCTCATAGGGACAATAGG - Intergenic
1122141119 14:99663724-99663746 CCATTTTCCATAGGAACAAACGG - Intronic
1125337572 15:38642269-38642291 CTAATCTCCTTAGGGGAAGAAGG + Intergenic
1125977938 15:43972332-43972354 TTATTCTCCTTTGGGTTAAATGG + Intronic
1125979639 15:43988743-43988765 CCATTCTCCTTAGAGAGAAGTGG + Intronic
1126259826 15:46676271-46676293 CCATTCTCCTGATGAACAAAGGG - Intergenic
1130406365 15:83605809-83605831 CTTTTCTCTTTGGGGACAGAGGG - Intronic
1130766423 15:86876048-86876070 CTCTTATTCTTAGTGACAAAAGG - Intronic
1130953163 15:88608052-88608074 TTATTTTCTTTATGGACAAAGGG + Intergenic
1133615453 16:7472228-7472250 TTATTCTCCTTTAGGATAAAAGG + Intronic
1137050340 16:35705996-35706018 TTATTCACCATAGGCACAAATGG - Intergenic
1138228658 16:55322489-55322511 AAATTCTGCTTAGGAACAAATGG + Intergenic
1139324561 16:66142159-66142181 CTGTACTCCTGAGGGACAAAAGG + Intergenic
1139526767 16:67521547-67521569 CCTTTCTCCTAAGGGACAAGTGG - Intronic
1146548211 17:33757304-33757326 AGATTCTCCTGCGGGACAAAAGG + Intronic
1150629358 17:66868191-66868213 CCATTTTCCGTAGGGACCAAGGG - Intronic
1155253133 18:23970266-23970288 CTAATCACCCTAGGGACAGATGG + Intergenic
1156141887 18:34122371-34122393 CTATTCTCCTTAGTGACCTATGG - Intronic
1156512687 18:37654498-37654520 TTATTTTCCTGAGGGACATAAGG - Intergenic
1158701393 18:59751343-59751365 CTTTTCTTCAAAGGGACAAATGG + Intergenic
1159022696 18:63156218-63156240 TTATTTTCCTGAGGGACAATGGG - Intronic
1159965805 18:74595149-74595171 ATATTATCCTTAGGAACAATTGG + Intergenic
1160100049 18:75912082-75912104 CTACAAGCCTTAGGGACAAATGG + Intergenic
1161183792 19:2902343-2902365 TTCTTCTCCTTAGTGACAATAGG + Intronic
1164993415 19:32701106-32701128 ATATTCTTCTTAGGTGCAAAGGG - Intronic
1166284275 19:41814186-41814208 CAATCCTCCTGAGGGACAAGTGG + Intergenic
925604304 2:5642548-5642570 CTATCCTCCTTACTTACAAAGGG - Intergenic
925641001 2:5985787-5985809 TTATTTTCCTTGTGGACAAATGG - Intergenic
930328664 2:49954156-49954178 CTATTCAACTGAGGGACAAGAGG - Intronic
935810593 2:106793459-106793481 CTACTCTGCTTGGGGAGAAAGGG + Intergenic
935856581 2:107281260-107281282 GTTTTCTGCTTAGGAACAAAAGG + Intergenic
938282414 2:130073915-130073937 CCATTCTCCTTAGAGAGAAGTGG + Exonic
938333044 2:130462487-130462509 CCATTCTCCTTAGAGAGAAGTGG + Exonic
938356765 2:130658184-130658206 CCATTCTCCTTAGAGAGAAGTGG - Intergenic
938433201 2:131264990-131265012 CCATTCTCCTTAGAGAGAAGTGG - Exonic
938477250 2:131627573-131627595 CCATTCTCCTTAGAGAGAAGTGG - Intergenic
942224147 2:173800170-173800192 ATATTCTCCTTAGTTAAAAATGG - Intergenic
942504406 2:176626473-176626495 CCATTCTCCTTAGAGAGAAGTGG + Intergenic
945724604 2:213460994-213461016 CTATTCTTCTGAGGTAGAAATGG - Intronic
947048943 2:226020433-226020455 CTTTTCTCCCTTGGGAGAAAAGG - Intergenic
1169111273 20:3035775-3035797 TTATTCTCCTTTGGAAAAAAGGG - Exonic
1169457341 20:5763435-5763457 GTATTCTACTTAGGAACAAAAGG - Intronic
1173454508 20:43191548-43191570 CTATAGCCCTTAGGGACAATTGG + Intergenic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1178932140 21:36828501-36828523 CTATTCTTCTTTTGGAAAAAAGG - Intronic
1180477265 22:15722918-15722940 CCATTCTCCTTAGAGAGAAGTGG - Intergenic
1181347434 22:22230191-22230213 CTCTTCTCCTCGGGGACAACTGG - Intergenic
1181679819 22:24486258-24486280 CTCCTCTCCTTAGGGACATGTGG + Intergenic
1183622788 22:38984194-38984216 CAAATCTCCTTTGGGACACAGGG + Exonic
1183629205 22:39022941-39022963 CAAATCTCCTTTGGGACACAGGG + Exonic
1183895704 22:40967101-40967123 GTATTCTTATGAGGGACAAACGG - Intronic
1183910251 22:41073837-41073859 CCATTCTCCTTAGAGAGAAGTGG + Intergenic
1184981968 22:48101351-48101373 CCATTCTCCTGAGGAGCAAAGGG - Intergenic
952520780 3:34155060-34155082 CTATTTTGCTGAGGGAGAAATGG + Intergenic
955093810 3:55777126-55777148 GATTTCTCCTCAGGGACAAATGG + Intronic
958744458 3:98115506-98115528 CTATTCTCCTTTGGCCCACAAGG + Intergenic
959110296 3:102115044-102115066 CTCCTCTCCTTTGGGACACATGG + Intronic
960775393 3:121245982-121246004 ATATTCTCCTTAAGCACACATGG + Intronic
964046681 3:152336806-152336828 CTATTTTACTTTGAGACAAATGG - Intronic
964503938 3:157377975-157377997 CTATTTTCCCTATGGACACAAGG - Intronic
965744334 3:171908056-171908078 TTATTCCACTTAGAGACAAATGG - Intronic
965934666 3:174092765-174092787 ATATTCTCTTTAGGGACACCTGG - Intronic
966282264 3:178245629-178245651 CTTTTCACCCTAGGGTCAAAGGG + Intergenic
967196256 3:187028654-187028676 TGATTCACCTTGGGGACAAATGG - Intronic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
968603802 4:1522138-1522160 CTCCTCACCTCAGGGACAAAGGG - Intergenic
974381013 4:61139947-61139969 CTATTCTCCTTTGGGGCAACTGG + Intergenic
975412073 4:74065046-74065068 CCTTTCTGCTTAGGAACAAAAGG - Intergenic
979788305 4:124745353-124745375 CTATTTTTCTAAGTGACAAAAGG - Intergenic
981410279 4:144422123-144422145 CTATTCTAGTTGGGGATAAAGGG + Intergenic
985581830 5:701555-701577 GCATTCTCCTTAGGCACACAAGG - Intergenic
985596445 5:792872-792894 GCATTCTCCTTAGGCACACAAGG - Intergenic
985983827 5:3496455-3496477 CTATGATCCTTGGGGACAAAAGG + Intergenic
991135524 5:63177474-63177496 CTACAATCCTTGGGGACAAATGG - Intergenic
992721206 5:79563093-79563115 TCACTTTCCTTAGGGACAAATGG - Intergenic
995184604 5:109258903-109258925 CCATTTTCCTTCGGGCCAAAAGG - Intergenic
996944513 5:129050491-129050513 CTATTCTCCTCAGAGACCTATGG - Intergenic
997165704 5:131658700-131658722 CCATTCTCCTTAGAGAGAAATGG + Intronic
999030708 5:148288006-148288028 CTATTCTCCTTGGACAAAAAAGG - Intergenic
999410585 5:151346619-151346641 CTAGTTTACTTAGGAACAAAAGG - Intronic
999525622 5:152402934-152402956 CTATTCACCTTAGGGACAATAGG + Intronic
999678510 5:154031922-154031944 CCTTTCTGCTTAGGAACAAAAGG - Intronic
1002045428 5:176538875-176538897 CAATTGTCCTTAGGGAGAACTGG + Intergenic
1004256156 6:14066492-14066514 TCATTCACCTTAGAGACAAATGG + Intergenic
1007821230 6:44561786-44561808 CTATTCTGCGGAGTGACAAATGG - Intergenic
1011526887 6:88275560-88275582 CCATTCTCCTTAGAGAGAAGTGG + Intergenic
1011543518 6:88459224-88459246 CTGTATTCCTTAGGGAAAAATGG + Intergenic
1013126949 6:107193088-107193110 GTTTTCCCCTCAGGGACAAATGG - Intronic
1016663122 6:146604282-146604304 CCATTCTCCTTAGAGACAAGTGG - Intronic
1020124799 7:5527421-5527443 CCATTCTCCTTAGAGAGAAGTGG + Exonic
1021466875 7:20954136-20954158 CTACTCTCCTTAGGAAGAAAGGG + Intergenic
1024361562 7:48474096-48474118 TTATTCACTTTAGGGGCAAAGGG + Intronic
1025008266 7:55372808-55372830 ATATTTTCCTTAGGAAAAAAAGG - Intronic
1025725107 7:64050495-64050517 GTGTCCTCCTTAGTGACAAAAGG + Intronic
1030572109 7:111239958-111239980 CCTTATTCCTTAGGGACAAAAGG - Intronic
1032554484 7:132817445-132817467 CTATTCTCCTTAGGGACAAAAGG + Intronic
1036129431 8:6094895-6094917 TTTTTCTCCTTAGAGATAAATGG - Intergenic
1039756698 8:40531012-40531034 CTATGGTCGTTAGGGACACAGGG + Exonic
1041681949 8:60602859-60602881 TTATTCTCCTAAGGAACAAAAGG - Intronic
1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG + Intergenic
1043140524 8:76583291-76583313 CTATGCTCCTTAAGGATTAAGGG + Intergenic
1043391513 8:79796664-79796686 TCATTCTCCTTAGGGAATAAAGG - Intergenic
1045239056 8:100382538-100382560 GTATTGTCCTTATGCACAAACGG + Intronic
1050073245 9:1838473-1838495 CCATTTTACTTAGGGGCAAAAGG - Intergenic
1051194692 9:14551017-14551039 CTTTTATACTTAGGGAAAAAAGG + Intergenic
1052086454 9:24272547-24272569 CAATTCTGCCTAGGGAGAAATGG - Intergenic
1053187007 9:36024802-36024824 CCAATGTCCTTAGGGAGAAATGG + Intergenic
1055725939 9:79228877-79228899 CTATTCTCCTTCCTCACAAATGG - Intergenic
1058084366 9:100732667-100732689 CCATTCTCCTTAGAGAGAAGTGG - Intergenic
1058820277 9:108723134-108723156 TTTTTCTCCTTATGGACACAGGG + Intergenic
1059364215 9:113773080-113773102 CAATTCTCCTTCGGCAGAAAAGG - Intergenic
1187049591 X:15682689-15682711 ATATTCTCCTTGGGGAAAACAGG - Intergenic
1187681009 X:21768043-21768065 CTATTCTCTTTGGTGACACATGG + Intergenic
1189812625 X:44794621-44794643 CCATTCTCCTTAGAGAGAAGTGG - Intergenic
1190784650 X:53633549-53633571 CCATTCTCTTTAGGAAAAAAAGG + Intronic
1191953856 X:66623327-66623349 CTATTCTCCCTAGAAAAAAATGG - Intronic
1195304867 X:103571668-103571690 CTAAACTCCTTAGGGAGAAAAGG + Intergenic
1196887882 X:120264588-120264610 CTATTAGCCTCAGGGTCAAAAGG + Intronic
1200014208 X:153146827-153146849 CCCTTCTCCTTTGGGAGAAATGG - Intergenic
1200025392 X:153253125-153253147 CCCTTCTCCTTTGGGAGAAATGG + Intergenic