ID: 1032555355

View in Genome Browser
Species Human (GRCh38)
Location 7:132827386-132827408
Sequence TCAGGAAGAAAATGACCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032555355_1032555358 5 Left 1032555355 7:132827386-132827408 CCTGAAGGTCATTTTCTTCCTGA 0: 1
1: 0
2: 3
3: 20
4: 286
Right 1032555358 7:132827414-132827436 AGTCAACAGACTACATGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032555355 Original CRISPR TCAGGAAGAAAATGACCTTC AGG (reversed) Intronic
900247969 1:1647958-1647980 GCAGTAAGAATCTGACCTTCTGG - Intronic
900259196 1:1715109-1715131 GCAGTAAGAATCTGACCTTCTGG - Intronic
901209287 1:7515314-7515336 TCAGGAAGAAAGAGGCCTTAAGG + Intronic
903275455 1:22218553-22218575 TGAGAAGGCAAATGACCTTCAGG - Intergenic
904561007 1:31397373-31397395 ACAGAAAGATAATGACCTTTTGG - Intergenic
904817220 1:33213292-33213314 TGATTAAGAAAATGAACTTCAGG - Intergenic
905303870 1:37004425-37004447 CCAGGGAGAAATTGAGCTTCGGG + Intronic
905399161 1:37689508-37689530 TCAAGGAGAAAAACACCTTCTGG + Intronic
906024365 1:42660399-42660421 TCAGGAAAAGAATAATCTTCAGG + Intronic
906729655 1:48070278-48070300 TCAGGAAGAAAGTACCCTTGGGG + Intergenic
907520199 1:55018773-55018795 TCTGCATGAAAATGACCTTGAGG + Intergenic
907726567 1:57025659-57025681 TCAGGAAGCACATCTCCTTCGGG + Intronic
911133403 1:94414387-94414409 ATAGGAAGAAAATGACTTTGTGG - Intergenic
911323890 1:96446473-96446495 CCAGGCAGAAATTGAACTTCTGG - Intergenic
912243535 1:107937422-107937444 GCAGGAAGGAAATGACATACTGG - Intronic
914445808 1:147749758-147749780 AGAGGAAGAAAATGCCCTTTTGG + Intergenic
916026886 1:160840901-160840923 CCAGGAAGAAAATAATGTTCAGG + Intronic
916686597 1:167152691-167152713 ACAGGAAGTCAATGACCTTGAGG + Intergenic
917416065 1:174810799-174810821 TAATGAAAAAAATAACCTTCAGG + Intronic
917433545 1:174996638-174996660 TCAGCAGATAAATGACCTTCTGG - Intergenic
917608594 1:176662763-176662785 TCAAGAGGAAAATGGCCTTTTGG - Intronic
918229884 1:182518547-182518569 TCAGGAACAAATTTCCCTTCAGG + Intronic
919656234 1:200200171-200200193 TCAGAAAGGAAATGGCTTTCAGG - Intergenic
922008665 1:221558470-221558492 TTAGGGACAAAATGCCCTTCTGG - Intergenic
922865484 1:228858040-228858062 TCAGGTAGAGAATGACTCTCAGG - Intergenic
924560588 1:245154515-245154537 TCAGGAAGAGAAAGAACTTGGGG + Intergenic
1063488485 10:6441898-6441920 GAAGGAAGCAAAGGACCTTCTGG - Exonic
1064207484 10:13336243-13336265 TCAGTAATAAAATGACCGACAGG - Exonic
1064303785 10:14147252-14147274 TTAGGAATATAATGACCATCAGG - Intronic
1064906678 10:20354502-20354524 CCAGAAAAAAAATTACCTTCAGG + Intergenic
1067658287 10:48213941-48213963 CCAGGAAGAAAATGAACTCGGGG + Intronic
1067842143 10:49689296-49689318 TCAGGAAGAAAATTACCAGTGGG + Intronic
1068228633 10:54140361-54140383 TCAGGAATAAAATATCCATCAGG + Intronic
1068762506 10:60728827-60728849 ACATGATGAAATTGACCTTCAGG - Intronic
1069415806 10:68199947-68199969 TCAGGTAGAAAAGGACATTCAGG - Intronic
1069415808 10:68199965-68199987 CCAGGCAGAAAAGGACATTCAGG - Intronic
1069564941 10:69457509-69457531 TCAGGAAGAAAAGGACTTGGTGG + Intronic
1069658279 10:70106447-70106469 TCAAGTAAAAAATGACTTTCAGG - Intronic
1069896427 10:71682946-71682968 GAAGGGAGAAGATGACCTTCTGG - Intronic
1072211779 10:93252946-93252968 GAAGGAAGAAAATGAGGTTCTGG - Intergenic
1073650321 10:105351825-105351847 TTAGGTAGGAAATGACCATCAGG - Intergenic
1074572126 10:114633560-114633582 TTAGGAAAAACATGACCTTATGG - Intronic
1076900527 10:133335510-133335532 TCAGGAAGAAAAAGCCATTGGGG + Intronic
1079494610 11:21027737-21027759 ACAAGAAGAAAAAGTCCTTCAGG - Intronic
1082742872 11:56930426-56930448 TTAGAAATAAAATGACCTGCAGG - Intergenic
1084200977 11:67558103-67558125 TCAGAAATAAATTCACCTTCCGG + Intergenic
1085136986 11:74099941-74099963 TGAGGAATGAAATAACCTTCAGG + Intronic
1087290161 11:96312334-96312356 TAAAGAAGAAAATGCCCTTTAGG - Intronic
1089014542 11:115155570-115155592 TCAGGAAGCACGTGGCCTTCTGG - Intergenic
1090057858 11:123438864-123438886 TCAGGAAGAAAATTCCCCACTGG - Intergenic
1090459336 11:126876264-126876286 TCAGGAAGAAACAGATCTGCTGG + Intronic
1090910157 11:131111520-131111542 TCAGGAGGAAGATGAGCTCCTGG - Intergenic
1091617085 12:2057764-2057786 TCAGGGAGAAAATTAACATCTGG - Intronic
1092051283 12:5472485-5472507 TCAGGAATTATATGACATTCGGG + Intronic
1094165252 12:27436585-27436607 TCAGGGAAATAATGAGCTTCCGG + Intergenic
1095288952 12:40452940-40452962 TCAGAAGGAAAAGGACTTTCTGG + Intronic
1095938214 12:47707993-47708015 TTAGGAAGAAAATGAACCTTGGG + Intergenic
1096864591 12:54554855-54554877 CCATGATGAAAAAGACCTTCAGG - Intronic
1097533548 12:60836838-60836860 TCAGGTAGAAAAAAACATTCAGG + Intergenic
1098253415 12:68591986-68592008 ACAGGAAGAAAACAACTTTCAGG - Intergenic
1098586694 12:72162877-72162899 TGAGGAAGAAAAGGACTTTGGGG + Intronic
1099539763 12:83893084-83893106 TCAAGAAAAAAATGACATTTTGG - Intergenic
1101241762 12:102846181-102846203 TCAGTGAGAAGATAACCTTCTGG + Intronic
1102031331 12:109741683-109741705 TCTGGAAGAAAGTGACCTGGAGG + Intronic
1102274452 12:111569870-111569892 TCAGGTAGAAAAGGATCTTAGGG + Intronic
1103947232 12:124533167-124533189 CCAGGAAGCAGATGACCTGCAGG + Intronic
1105006770 12:132726185-132726207 CCAGGAAGAAACCGACCTCCAGG + Exonic
1105023008 12:132829412-132829434 TCAGGAAGGAAATGGCCTGGAGG + Intronic
1106208964 13:27623280-27623302 TCAGGAAGAGAATATCCTACAGG - Exonic
1106464440 13:30000078-30000100 TCAGAATGAAAATGACACTCTGG + Intergenic
1108157143 13:47596990-47597012 TAATGAAGAAAATGATTTTCAGG - Intergenic
1109426673 13:62173233-62173255 TAAGGAAGAAAATAAACTTTAGG - Intergenic
1110510024 13:76339235-76339257 TCAGGAAAAAAAATAGCTTCAGG - Intergenic
1110895587 13:80747749-80747771 CCAGCAAAAAAATGAACTTCTGG + Intergenic
1112169061 13:96950878-96950900 TGAGGAAAAAAATGAGCTTCAGG - Intergenic
1114364968 14:22016001-22016023 TCAGGAAGAAAAAGGCATTTGGG - Intergenic
1115677519 14:35695829-35695851 TCAGGAAAATAATGACTGTCAGG + Intronic
1115972513 14:38961802-38961824 TCATGAAGGAAATGACCATTTGG - Intergenic
1116376770 14:44212176-44212198 TGAGGAAGAAACTGAGATTCTGG - Intergenic
1116544928 14:46153078-46153100 TCAGGAACAAAATGACATAACGG - Intergenic
1116837675 14:49786879-49786901 TTAGGAAGAATATAACCTTGAGG - Intronic
1118393794 14:65318522-65318544 TCTGGAAGAAAATGAGCTGTGGG - Intergenic
1118927016 14:70200218-70200240 TCAATAAGAAAAAGACCTTATGG - Intergenic
1125049578 15:35281480-35281502 TCATGAAGAAAATGACCAAAAGG + Intronic
1126936207 15:53711281-53711303 TCAGGTAGAAAATGAACTTTGGG - Intronic
1127685223 15:61337185-61337207 TCAGGAAGACATAGACCTTGAGG + Intergenic
1127742146 15:61920589-61920611 TCAGGAATAAAATCATCTCCTGG + Exonic
1128649668 15:69401285-69401307 TCAGGAACAAAATGGGCTTGGGG - Intronic
1128774812 15:70312085-70312107 AGAGAAAGAAAATGAGCTTCTGG + Intergenic
1129506310 15:76084371-76084393 TAAGGAAGACAATGGCATTCTGG + Intronic
1129791921 15:78346888-78346910 TCTGAAAGATAAGGACCTTCTGG + Intronic
1130536075 15:84785960-84785982 TCATGAAGAGAACCACCTTCTGG - Intronic
1133662458 16:7932085-7932107 TCAGGCTGAGAATGCCCTTCTGG - Intergenic
1133676197 16:8075307-8075329 CCTAGAAGAAAATTACCTTCAGG - Intergenic
1134529350 16:14970865-14970887 TCAAGAAGAAAGTGATCATCTGG + Intergenic
1135555496 16:23432908-23432930 ATGGGAAGAAAATGGCCTTCAGG + Intronic
1135661900 16:24304070-24304092 CCAGGAAGATAGTGACCTTGTGG + Intronic
1137723278 16:50640234-50640256 GCAGGAAGACCAAGACCTTCAGG + Exonic
1138923260 16:61558407-61558429 CCAGGAAGAAAATGGCTTTATGG + Intergenic
1138949919 16:61899618-61899640 TGAGGAACAAAATCACCTTAAGG + Intronic
1139867001 16:70070089-70070111 TCAAGAAGAAAGTGATCATCTGG - Intergenic
1140707690 16:77646094-77646116 TCAGGAGGAAGATTACCTTGAGG + Intergenic
1141477336 16:84282712-84282734 TCAGGAAGTGGATGACCCTCAGG + Intergenic
1149886498 17:60345361-60345383 TCAGGAAGAAAAATAACTACAGG + Intronic
1150440436 17:65186989-65187011 TCAGGTAGAAAAGGACCCTGGGG - Intronic
1154405282 18:14084929-14084951 TCAGGAAGAATGTGTCCTTCAGG - Intronic
1157985032 18:52427656-52427678 GGAGTAAGAAAATCACCTTCAGG - Intronic
1158374904 18:56851990-56852012 TCACAGAGAAAATGACCCTCTGG + Intronic
1158772960 18:60543786-60543808 TCAGGAAGTGAGTGACCTTAAGG + Intergenic
1159491982 18:69148422-69148444 GCAGGAAGAAAAGGCCATTCAGG + Intergenic
1160361088 18:78279721-78279743 TCAGGAAGAAAATGAAAACCTGG - Intergenic
1160994172 19:1874281-1874303 TCAGGAAGACAATGGGGTTCTGG + Intergenic
1162388269 19:10373860-10373882 TGAGGAAGCGAAAGACCTTCAGG - Intronic
1163306762 19:16484824-16484846 TCAGGATGAAAAAAACATTCTGG - Intronic
1164009023 19:21180646-21180668 TCTGGTAAAAAATGAACTTCAGG + Intronic
1164456091 19:28408248-28408270 CCATGATGAAAATAACCTTCGGG - Intergenic
1165227899 19:34366975-34366997 GCAGGAGGAAAAAGGCCTTCAGG - Intronic
1165364681 19:35358254-35358276 TCAGGAAGAAACAGACCTCACGG + Intergenic
1166351950 19:42203428-42203450 CCAGAGAGAAAATGAACTTCAGG + Intronic
1168168059 19:54567421-54567443 TCAGCAAGAAGATGACCTCATGG - Intergenic
1168378246 19:55898831-55898853 TTTGGGAGAAAATGATCTTCAGG - Exonic
926469015 2:13229723-13229745 TCAGCAAGAAAATGATCTTACGG + Intergenic
927219754 2:20696071-20696093 TCAGGATGATTATGACATTCTGG + Intronic
927941107 2:27103371-27103393 TCAGAAAAAAAAAGACCTTATGG - Intronic
928195279 2:29211768-29211790 TCTGGCAGAAACTGTCCTTCTGG - Intronic
930982935 2:57549970-57549992 TCAGGAAGTAAGACACCTTCTGG - Intergenic
932401928 2:71486615-71486637 TCAGGAAGGAAATCTCCATCTGG + Intronic
933558431 2:83861167-83861189 TGATGAGGAAAATGACTTTCAGG - Intergenic
936964030 2:118108901-118108923 ACAGGGTGAAAATGAACTTCTGG + Exonic
937012912 2:118577577-118577599 TAAGCAAGAAAATCACCATCAGG - Intergenic
937190374 2:120090895-120090917 TCATGAGAATAATGACCTTCAGG - Intronic
938945139 2:136205551-136205573 TCAGGAAGCTCATGTCCTTCAGG + Intergenic
939076241 2:137606143-137606165 TCAGGAAGAGAATGTTTTTCTGG + Intronic
939420315 2:141959062-141959084 AAAGGAAGAAAATGAGCTTGAGG - Intronic
941322097 2:164068582-164068604 CCAGTGAGAAAATGACCCTCTGG + Intergenic
942928540 2:181461301-181461323 GCAGGAAGAAAAGCACCTTGCGG - Intronic
944056994 2:195532845-195532867 TTAAAAAGAAAATGCCCTTCAGG + Intergenic
944867656 2:203878503-203878525 GCAGGAAGAAAATGACAAGCAGG - Intergenic
945362336 2:208906842-208906864 GCAGGTAGAGAATGACCATCAGG - Intergenic
945474208 2:210262758-210262780 TAAAGAAGAAAATGACATTTTGG + Intergenic
945707213 2:213250098-213250120 AAAGGAAGAAAATGAACTTTAGG + Intergenic
946647453 2:221853100-221853122 TCAGGAAAAAAATGGCATCCTGG - Intergenic
947047250 2:226001824-226001846 TCAAGAAGAATAGGTCCTTCAGG - Intergenic
947373219 2:229469283-229469305 GCAGAAAGAACATGAACTTCAGG + Intronic
1170399189 20:15961265-15961287 TCAGGAATAAATTGATGTTCGGG + Intronic
1170809303 20:19661256-19661278 GCAGGGAAAAAATGACCTACGGG - Intronic
1171776651 20:29374497-29374519 TCAGGAAAAAAGTGACATGCTGG + Intergenic
1171818046 20:29805975-29805997 TCAGAAAAAAAATGACATGCTGG + Intergenic
1171900197 20:30849303-30849325 TCAGGAAAAAAGTGACATGCTGG - Intergenic
1172028339 20:31964788-31964810 TCAGGTAGAAATTGAAATTCAGG - Intergenic
1172329198 20:34062979-34063001 AGAGGAAGAAACTGACCTCCAGG + Intronic
1173889734 20:46497098-46497120 GCAGGAAGGAAATGACTTTTGGG + Intergenic
1175162285 20:57017822-57017844 AGATGAAGAAAGTGACCTTCAGG - Intergenic
1175286527 20:57840465-57840487 TCTGGTAGAACATGAGCTTCAGG - Intergenic
1176679884 21:9813735-9813757 TCTGGAGGAGAATGACCCTCGGG + Intergenic
1177595552 21:23236830-23236852 TCATCAAGAAAACCACCTTCTGG + Intergenic
1179193536 21:39143655-39143677 TGAGGAAGCAAATTGCCTTCAGG - Intergenic
1179234120 21:39529791-39529813 ACGGGAAGAAAATGAGCATCTGG + Intergenic
1179715792 21:43287465-43287487 TCAGGCAGAACGTGACCTTTTGG + Intergenic
1180321492 22:11325459-11325481 TCAGGAAAAAAGTGACATGCTGG + Intergenic
1180333562 22:11555298-11555320 TCAGGAAAAAAGTGACATGCTGG - Intergenic
1180936410 22:19628080-19628102 TTAGGAAGATGAAGACCTTCTGG - Intergenic
1183564688 22:38605363-38605385 TTAGCAAGAAAATGACCATTAGG + Intronic
1184149332 22:42629326-42629348 GAAGGAAGAAAAGGAGCTTCAGG - Intronic
949750492 3:7347052-7347074 CCAGGAAAAAAATGCCCTTGAGG + Intronic
950517737 3:13478878-13478900 AAAGGAAGAAAATGAAGTTCTGG - Intergenic
953830398 3:46292904-46292926 TCTGGAAAAAAAAAACCTTCTGG + Intergenic
955208202 3:56916597-56916619 TCAGTCAGAAACTGAACTTCTGG - Intronic
955883145 3:63569280-63569302 TCAGGAAGATAATCAACTTCTGG - Intronic
956522897 3:70124987-70125009 ACAGGAAGAAATTGACCACCTGG - Intergenic
957088432 3:75705149-75705171 TCAGGAAAAAAGTGACATGCTGG - Intergenic
957191078 3:77010798-77010820 AGAGAAAGAAAAAGACCTTCAGG - Intronic
957811800 3:85231564-85231586 TGAGGAAGAATATTACTTTCTGG + Intronic
959330481 3:104998068-104998090 TAAGGAAAAAAAAGAACTTCTGG + Intergenic
960216659 3:115047353-115047375 TCAGGAAGAAAAAGGACTGCTGG + Intronic
960809383 3:121613465-121613487 TCAGGGCAAAAATGACATTCTGG + Intronic
961638151 3:128346953-128346975 TCAGGAAGAATTTGACCCTTTGG + Intronic
962949226 3:140202830-140202852 TCAGGAAAAAAAGGACCTGTTGG - Intronic
963994339 3:151690193-151690215 TCATGAAGAAAATTAAATTCAGG - Intergenic
964027013 3:152086893-152086915 TGAGGAAGATAATGACATCCAGG - Intergenic
964646158 3:158960332-158960354 TCAGGAGAAAGATGACCGTCTGG - Intergenic
964962091 3:162439217-162439239 TCAGCAGGAAAATGACCATTTGG - Intergenic
965358900 3:167712023-167712045 TCTGAAAGAAAAGGACATTCAGG + Intronic
965976776 3:174634263-174634285 TCAAGTAGAATATGATCTTCTGG - Intronic
967041317 3:185695701-185695723 GCAGGAAGAAAAGTATCTTCTGG + Intronic
967411384 3:189169726-189169748 TGAGGGAGAAAATGAGCTCCTGG - Intronic
968980554 4:3846912-3846934 TAAGGAAGAAAATATCCTTCAGG + Intergenic
970193264 4:13534360-13534382 TGAGAAAGAAAAAGACGTTCCGG - Intergenic
970405758 4:15761751-15761773 CCAGGAATATAAAGACCTTCTGG - Intergenic
971217622 4:24675699-24675721 TCAGGAACAAACTGCCCTCCTGG - Intergenic
971235447 4:24837751-24837773 AGAGGAAGAAAATGAACTTTAGG + Intronic
972787902 4:42344784-42344806 ACAGGAAGATAATGATATTCTGG + Intergenic
973029972 4:45325365-45325387 TCAGGAGTAAAATTACCTTCTGG + Intergenic
973269118 4:48243170-48243192 TCAGGAAAAAAAAGATCTTCGGG - Intronic
973345400 4:49049444-49049466 CCAGGTAGAGAATCACCTTCAGG - Intronic
974136619 4:57826248-57826270 TCATGAAGAAAATGACAACCTGG + Intergenic
974586358 4:63884085-63884107 TCAGAAAGAAAAGGACATTAAGG - Intergenic
976000215 4:80365411-80365433 TCATGAAGCAAAGGACCTTTTGG + Intronic
977340346 4:95749880-95749902 TCTGGAAAAAAATGAACTTCTGG - Intergenic
978305174 4:107320342-107320364 TCATGAATAAAATGGCCTTTGGG - Intergenic
980124338 4:128759526-128759548 TCAGTAAGAAGATGAGTTTCAGG + Intergenic
981397772 4:144274365-144274387 TCTTGAGGAAAATGACCTTTGGG - Intergenic
981893921 4:149774305-149774327 TCTGCAAGAAAAAGAACTTCTGG - Intergenic
981935813 4:150238853-150238875 TTAGAAAGAAAATGACCTTTGGG - Intronic
982137889 4:152289603-152289625 TAAGGAAGAAAATGAGCATAAGG - Intergenic
982369285 4:154616753-154616775 GCAGAAAGAAAATGACCTATTGG + Intergenic
982937398 4:161499369-161499391 CCAGGAGGAAACTGACCTCCTGG + Intronic
983163123 4:164442043-164442065 TCAGGGAGGAAAAGACGTTCTGG - Intergenic
983207774 4:164929575-164929597 GCAGGAAGATAATCACCATCAGG - Intergenic
983211012 4:164957393-164957415 TCAGGAAGAGAACCACCATCAGG + Exonic
984191857 4:176615291-176615313 TCATAAAGAAAATGACTTTATGG - Intergenic
985286258 4:188339130-188339152 GCAGGTAGAAAATAGCCTTCAGG + Intergenic
985364183 4:189209406-189209428 TCAGGAAGAACATGCACTTCTGG - Intergenic
986504415 5:8433818-8433840 TCAAGAAGCAACTGACATTCAGG + Intergenic
988069013 5:26263223-26263245 TCAGGAAGAAATTGAAGTACTGG - Intergenic
989549995 5:42723364-42723386 AGAGGAAGGAAAAGACCTTCTGG + Intergenic
990497029 5:56358753-56358775 CCAGAAGGAAAATGCCCTTCAGG + Intergenic
990628002 5:57635914-57635936 GCAGAAAGAAAAGGACATTCAGG + Intergenic
991315729 5:65303538-65303560 TCAGAAAGAAAATTTTCTTCTGG - Intronic
991613733 5:68474712-68474734 ACAGGTAGAAAATGGCTTTCTGG - Intergenic
991649869 5:68840895-68840917 TCAGCATGAATATGAACTTCAGG + Intergenic
992208949 5:74458608-74458630 TAAGGAAGAAAAGGATCTTTGGG + Intergenic
992503758 5:77365949-77365971 TCAGGAAGTAAAGTGCCTTCAGG - Intronic
992680265 5:79145841-79145863 TCAGGAAGAAAAGAAACTCCTGG - Intronic
993281515 5:85931078-85931100 TAAGGAAGAAAATGATCTCAAGG - Intergenic
994699773 5:103119789-103119811 TCAGCAGGAAAATGACCGTTTGG + Intronic
994825368 5:104707080-104707102 TCATGAAGAAAGTAACATTCGGG - Intergenic
995967681 5:117928848-117928870 TCAGGAAACAAGTGATCTTCAGG + Intergenic
998243225 5:140469594-140469616 ACAGGAATAAAATTACTTTCTGG + Intronic
998883444 5:146668919-146668941 TCAGGAAGAAAATGAATTAATGG - Intronic
1000151321 5:158504026-158504048 GGAGGAAGAAAATGACCCACAGG + Intergenic
1003046477 6:2737743-2737765 GAAAGAAGAAAATGTCCTTCAGG + Intronic
1003207635 6:4028030-4028052 TCAGGAAAAAAAAGACCTTCTGG + Intronic
1003788878 6:9520103-9520125 TGAGGAGGAAAATGTCCTTTTGG + Intergenic
1004919817 6:20366127-20366149 ACAGGAAGAAAATAAGATTCTGG + Intergenic
1006909402 6:37554531-37554553 CCAGGAAGAAAGTGAGCTTTAGG - Intergenic
1007897157 6:45374740-45374762 TCTGGAAGAAAATCATCTTTTGG - Intronic
1010506058 6:76661054-76661076 TCAGGAGTAAAGAGACCTTCTGG - Intergenic
1011639129 6:89402781-89402803 TCAGGGGGAAAAGGACCATCAGG - Intronic
1012331827 6:98000490-98000512 TCAGAAAGAAATTTACATTCAGG + Intergenic
1014523879 6:122478253-122478275 TAAGGCAGAAAATTTCCTTCAGG - Intronic
1014699470 6:124665788-124665810 TCAGAAAGGAAATGACTCTCAGG - Intronic
1015034511 6:128637097-128637119 TCAGGAAGGAGATGACATTTTGG - Intergenic
1015590896 6:134822069-134822091 GCAGCAAACAAATGACCTTCAGG + Intergenic
1017861756 6:158404822-158404844 TGAGGAAAAAAATGACCTTATGG - Intronic
1018921010 6:168174264-168174286 ACAGGAAGAAGCTGCCCTTCAGG - Intergenic
1019068084 6:169319472-169319494 TCAGGAAGACGCTGACCTCCAGG - Intergenic
1019369836 7:656034-656056 CCAAGGAGAAAATGACTTTCTGG - Intronic
1020364449 7:7365581-7365603 TCAGAAAGCAAAAGACCTTTTGG - Intronic
1021039579 7:15845313-15845335 TTAGGAAAACAATGACATTCAGG - Intergenic
1021808162 7:24377058-24377080 ACAGGGAGAAAATAACTTTCTGG + Intergenic
1023113101 7:36834081-36834103 TCAGGAAGAACATGAATTTTGGG - Intergenic
1024336434 7:48211559-48211581 TCAGGAAGAACATGAGCTTCAGG - Intronic
1025807891 7:64852955-64852977 TCAGTAATAAAATGACCAACAGG - Intergenic
1027633640 7:80641592-80641614 TCAGTAAGAAAATGTCATTTAGG + Intronic
1028109669 7:86924513-86924535 TTAGGAAAAAAAAAACCTTCAGG + Intronic
1030832472 7:114242569-114242591 TCAGAAAGATATTGACATTCTGG - Intronic
1030902485 7:115141498-115141520 TCTGGTAGAAAAGGACCTCCAGG + Intergenic
1032136658 7:129285589-129285611 TCAGGAAGAACATTTCCCTCTGG - Intronic
1032555355 7:132827386-132827408 TCAGGAAGAAAATGACCTTCAGG - Intronic
1034410824 7:150941241-150941263 TTGGGAAGAAAGTGACCTCCAGG + Intergenic
1034890639 7:154836020-154836042 TCAGGCACACTATGACCTTCAGG + Intronic
1039413701 8:37376204-37376226 TAAGGGAGGAAATGAGCTTCTGG + Intergenic
1039717659 8:40127687-40127709 ACAGGAAGAAAATGTTCTTGAGG + Intergenic
1040394916 8:46988497-46988519 TCTGGAAGAATGTGAACTTCTGG + Intergenic
1040765580 8:50906040-50906062 TCATGTATTAAATGACCTTCAGG + Intergenic
1043559364 8:81472489-81472511 TCTGAAAGAAAAAAACCTTCAGG + Intergenic
1044050664 8:87499376-87499398 TCAGGAATTAAGTGACATTCAGG + Intronic
1044368916 8:91385113-91385135 TCAGAAAGAAATTAACCATCAGG - Intronic
1044418325 8:91961630-91961652 TGAGGAAGAAACTAACCTTCAGG + Intronic
1044979113 8:97697337-97697359 ACAGTAAGCAAATGACTTTCTGG + Intronic
1045227042 8:100258768-100258790 TGAGGTAGAAAATGACCGTCTGG - Exonic
1045562839 8:103282524-103282546 GCAGTAAGAAAATGACTTTCAGG - Intergenic
1047005723 8:120618091-120618113 TCAGGTAGAGAAAGACTTTCCGG - Intronic
1048494890 8:134926895-134926917 TAAGCAAGAAGATGACCTTTGGG + Intergenic
1049237762 8:141520921-141520943 TCAGAAATAAGATGAGCTTCAGG + Intergenic
1049948958 9:625902-625924 TCAGGATGAAAATGATCATCTGG - Intronic
1050080929 9:1915064-1915086 AGAGAAAGAAAATGAGCTTCAGG + Intergenic
1050100113 9:2110312-2110334 TCAGCAAGAAAATGAAATACTGG - Exonic
1050329259 9:4528999-4529021 TGAGGAAGAAAGTGAAGTTCTGG - Intronic
1050336990 9:4599103-4599125 TCATGTATAAAATTACCTTCAGG - Intronic
1051130227 9:13852032-13852054 CCAGGAAGAAAATGACTTTCTGG + Intergenic
1051752718 9:20360400-20360422 TTAGGAAGAATATGACCTTTGGG - Intronic
1052243651 9:26306594-26306616 TGAGGATGAAAATGACATTTTGG - Intergenic
1054943021 9:70764447-70764469 TCATGCAGATAATGACCTTGGGG - Intronic
1057475728 9:95399523-95399545 GCAGGTAGAAAAAGACCATCAGG - Intergenic
1057734704 9:97645203-97645225 TCAGGAAGAAGATGTACCTCAGG + Exonic
1060024256 9:120157517-120157539 TCTGGAAGAGAATGACCTGGTGG + Intergenic
1062008321 9:134252823-134252845 TCAGGAAGGATGTGAGCTTCGGG + Intergenic
1203369708 Un_KI270442v1:291239-291261 TCAGGAAAAAAGTGACTTGCTGG + Intergenic
1185513122 X:677771-677793 CCAGGAAGAAAAGGACATTCAGG + Intergenic
1186104396 X:6190848-6190870 TCTAGAAGAAAATGGACTTCCGG + Intronic
1186214678 X:7286913-7286935 GCAGGAAGAAAATGAATTTTTGG + Intronic
1187591449 X:20721598-20721620 TCAGGAAGAAAATTAATTTGGGG - Intergenic
1188192563 X:27190192-27190214 TCAGGATGAAAAGGAGATTCAGG - Intergenic
1188479853 X:30626039-30626061 TCAAGAAGAAAAAGGCCTTATGG - Intergenic
1189008670 X:37022347-37022369 TCAGGAGGAAAATGCCACTCAGG - Intergenic
1190223239 X:48526625-48526647 TCAGAAAGAAAAAGACCGCCGGG - Intronic
1191648786 X:63513138-63513160 TCAGGAAGAAAATTAAATGCTGG - Intergenic
1191766765 X:64706143-64706165 TCAGGAAGACACTGAGCTGCAGG - Intergenic
1192213530 X:69142632-69142654 GCATGAAGAAAATGAAGTTCTGG - Intergenic
1192727733 X:73769630-73769652 TCAGTAATAAAATGACCGACAGG + Intergenic
1193468767 X:81875522-81875544 TCAGGAAGCAGATGAGCTTCTGG - Intergenic
1195793094 X:108611217-108611239 TGAGGAAGAAAATGTGCTTAAGG + Intronic
1196642445 X:118077756-118077778 TCAGGGAGAAAATGAACCTTGGG + Intronic
1198630754 X:138635468-138635490 TTAGGCAGAAAATGAGCTGCAGG + Exonic
1199312654 X:146339490-146339512 TCATGAAAAAAATAACCTTATGG - Intergenic
1199700256 X:150370619-150370641 TCTGGAAGAAAATGCTCTTGGGG - Intronic
1201759849 Y:17524750-17524772 TCAGGGAAAAAATGACATGCTGG + Intergenic
1201841705 Y:18381240-18381262 TCAGGGAAAAAATGACATGCTGG - Intergenic