ID: 1032555358

View in Genome Browser
Species Human (GRCh38)
Location 7:132827414-132827436
Sequence AGTCAACAGACTACATGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032555355_1032555358 5 Left 1032555355 7:132827386-132827408 CCTGAAGGTCATTTTCTTCCTGA 0: 1
1: 0
2: 3
3: 20
4: 286
Right 1032555358 7:132827414-132827436 AGTCAACAGACTACATGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032555358 Original CRISPR AGTCAACAGACTACATGTTG TGG Intronic
No off target data available for this crispr