ID: 1032558893

View in Genome Browser
Species Human (GRCh38)
Location 7:132867009-132867031
Sequence AAATGATGGTATGTGTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032558893 Original CRISPR AAATGATGGTATGTGTATGG TGG (reversed) Intronic
905318801 1:37101082-37101104 ATATGCATGTATGTGTATGGGGG - Intergenic
905358283 1:37400332-37400354 AAATGATGGTAAGATCATGGAGG + Intergenic
906280755 1:44551901-44551923 AAATGGAGGTATGTGTTAGGAGG - Intronic
906524804 1:46487876-46487898 GAATGATGCTATGTGTGTGCAGG + Intergenic
906957898 1:50391399-50391421 AAATGATAACATGTATATGGAGG - Intergenic
907362736 1:53932851-53932873 TATTGATGGGTTGTGTATGGTGG - Intronic
908400204 1:63765588-63765610 GAAGGATGGGAAGTGTATGGTGG - Intergenic
909182497 1:72441832-72441854 AAATTATGGTTTATGTATGTAGG - Intergenic
909583860 1:77267212-77267234 AAATGATGGTATTTGGATCAAGG + Intergenic
909811550 1:79937588-79937610 TAGTCATGCTATGTGTATGGGGG + Intergenic
910856614 1:91702236-91702258 AAAATATGGTAGGTGTATAGTGG - Intronic
915523785 1:156464092-156464114 AAGGAATGGTATTTGTATGGGGG - Exonic
916693198 1:167210684-167210706 AAATAATTGTCTGGGTATGGTGG + Intergenic
916885965 1:169068712-169068734 AAATGATGGAATCTGCAGGGAGG - Intergenic
916899571 1:169206120-169206142 ATATGATGGTAAGTGTGTAGGGG - Intronic
916925121 1:169511065-169511087 AAATGATGGTACATGTAGAGAGG + Intergenic
917048485 1:170890948-170890970 AAATGATGGTGTGTGGAGGTAGG - Intergenic
918615435 1:186539157-186539179 AAATGTTAGTATGTGCAGGGTGG + Intergenic
919160348 1:193821880-193821902 ATATGATGGTATTTGGATGTGGG - Intergenic
919405468 1:197176481-197176503 ATATGATGTTATGTTTATGTTGG - Intronic
919698975 1:200611715-200611737 GAATAATAGTATGTGGATGGGGG - Intronic
921392216 1:214627825-214627847 AAATTATGCTATGTTTATGCTGG + Intronic
922781213 1:228253920-228253942 AAATGATGGCCTGGGCATGGTGG - Intronic
924617458 1:245624402-245624424 AAATGCTGGTGGGGGTATGGAGG - Intronic
1064816778 10:19274387-19274409 ACGTGATGGTATTTGTATGTGGG + Intronic
1065420745 10:25541111-25541133 AAATCTTGATATGTATATGGAGG - Intronic
1065633018 10:27700811-27700833 AAATGAGAGTATGTGTTTAGTGG - Intronic
1065817726 10:29497373-29497395 AAGTGATGGTATGTGCATATAGG + Intronic
1065955079 10:30686464-30686486 AAATGATGGTATGTGCATATAGG - Intergenic
1068011918 10:51462529-51462551 CAAGGGTGGTATGTGTATAGTGG + Intronic
1068317156 10:55360963-55360985 AAATGATGGTATATTCATAGAGG + Intronic
1070165311 10:73893267-73893289 AAATGATGCTAGGTGGATGACGG + Intergenic
1070435153 10:76383894-76383916 AAATGATGGAAAGTGACTGGTGG - Intronic
1070451404 10:76561056-76561078 TAAGTATGGAATGTGTATGGGGG + Intergenic
1072809430 10:98447387-98447409 AAAAAATCGTATGTGTATTGGGG + Intergenic
1073797590 10:107004843-107004865 ATATGCTGGTATGTGTGTGTGGG + Intronic
1074046238 10:109841948-109841970 AAAGGGTGGTATGTGGAAGGAGG - Intergenic
1074162905 10:110848777-110848799 AGACTATGGTATGGGTATGGGGG - Intergenic
1075137608 10:119799353-119799375 AAAAGATAGCATGTATATGGAGG + Intronic
1075234398 10:120713450-120713472 AAAAGATGCTAAATGTATGGTGG - Intergenic
1075324105 10:121516878-121516900 AAATAGAGGGATGTGTATGGAGG - Intronic
1075467984 10:122665762-122665784 AAATAATGGTATGTTCATGAAGG + Intergenic
1078632220 11:13013019-13013041 AAATGATTGTCTGGGGATGGTGG - Intergenic
1078864424 11:15283495-15283517 AGATGAGTGTATGTGTGTGGGGG - Intergenic
1079066381 11:17297794-17297816 AAATGAGGGTCCGTGTGTGGTGG + Intronic
1080084591 11:28263907-28263929 AGATGATGGTAAGTGTTTTGAGG + Intronic
1080332990 11:31162636-31162658 AGACGATGGTGTGTGTATTGGGG + Intronic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1081663652 11:44903765-44903787 AAAGGATGGTGTGTGTGTGATGG - Intronic
1081947162 11:47007316-47007338 AAATGATGGGCTGGGCATGGTGG - Intronic
1088446386 11:109933503-109933525 AAATGATATAATGTGTATGGTGG + Intergenic
1088650599 11:111954720-111954742 AAATGATTTTATGTGTATTCAGG + Intronic
1088824572 11:113482979-113483001 CAATGGTAGTATGTGTCTGGAGG - Intergenic
1088948987 11:114546219-114546241 AAACCATTGTATGTGTATGCTGG + Intronic
1090188753 11:124754424-124754446 AAAAGAGGGAATGTGTATGGTGG - Intronic
1090461692 11:126896852-126896874 ACATGATGATATGTGAATGGGGG - Intronic
1093773573 12:23046392-23046414 AAATGATGAAATGTGTATCTGGG + Intergenic
1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG + Intergenic
1095354575 12:41256503-41256525 AAATGTTGGCTTGTGTATAGGGG - Intronic
1096119659 12:49079889-49079911 CAAGGATGGGATGTGTGTGGAGG + Intergenic
1096483812 12:51962289-51962311 AAAGGAAGCTATTTGTATGGTGG - Intronic
1096500105 12:52059544-52059566 TAATGATGGGGTGTGTCTGGTGG - Intergenic
1096500310 12:52060640-52060662 GAGTGAGGGTATGTGGATGGGGG - Intergenic
1096674068 12:53217144-53217166 AATTGATTGTATGTGTGTTGGGG - Intronic
1097657064 12:62378265-62378287 AAAGGATGGTATTTTTATGAGGG + Intronic
1097814376 12:64056048-64056070 GAATGTTGTTATGTGTGTGGAGG - Intronic
1099280638 12:80641322-80641344 AAATGAAGGAATATGAATGGAGG + Intronic
1101093453 12:101311989-101312011 AAATGTTGATATTTGTCTGGTGG + Intronic
1102426614 12:112848864-112848886 GAGTGAGGGTATGTGTTTGGAGG + Intronic
1102849439 12:116225999-116226021 AAAAGATTGTATGTATATGATGG - Intronic
1106275765 13:28204548-28204570 AAATCATGATATGTGTATAATGG + Intronic
1107492569 13:40895099-40895121 AAGTGATGGTATATGTATGTGGG + Intergenic
1108669827 13:52674448-52674470 AAATGATGGTATATGTATGTGGG - Intronic
1109621684 13:64916549-64916571 AAATGAAGGTATGGATAGGGAGG - Intergenic
1109797099 13:67329795-67329817 AAATGTAGGTATGAGGATGGGGG - Intergenic
1109849622 13:68044196-68044218 AAAGGTTTGTATGTGTGTGGTGG - Intergenic
1110747982 13:79078948-79078970 AAGTGAGGGTGTGTGTTTGGGGG - Intergenic
1111977718 13:94984619-94984641 AAATGATGGCATGTCTTTGGTGG - Intergenic
1114329119 14:21618169-21618191 CAATGAGGGTGTGTGTTTGGGGG + Intergenic
1114718442 14:24853755-24853777 AATTGTTGGTATGTGTATTTAGG - Intronic
1116428162 14:44815522-44815544 TAATGTGTGTATGTGTATGGTGG - Intergenic
1116709444 14:48347667-48347689 AAATAATGCTATCTGTAGGGGGG - Intergenic
1117384535 14:55197678-55197700 ATATGCTGGCATGTGCATGGTGG - Intergenic
1118872919 14:69758419-69758441 ATATGATGGTATTTGTAGGTGGG + Intronic
1119143716 14:72291275-72291297 AAATGATGGCATGGGGATGCTGG - Intronic
1119929786 14:78533889-78533911 AAATGATGTACTGAGTATGGAGG - Intronic
1120217288 14:81693918-81693940 ATATTTTGGTATGTGTCTGGTGG + Intergenic
1120766091 14:88327289-88327311 AAAGGAGGGTGTGTGTGTGGCGG - Intergenic
1121836835 14:97099845-97099867 AAATGATGGCATATGTTTGAGGG - Intergenic
1123812450 15:23942216-23942238 AAATGAATGAATGTGTAGGGAGG + Intergenic
1125121538 15:36164476-36164498 AAATGAAGAAATGTGTATGTGGG - Intergenic
1128296530 15:66525477-66525499 AAAGAATTGTATATGTATGGGGG - Intronic
1135463825 16:22668473-22668495 CAATGATAGTATGTGTCTGATGG - Intergenic
1135560215 16:23470380-23470402 AACTGGTGGTGTGTGTATGATGG - Intronic
1137043277 16:35633680-35633702 AAATGTTGGCAAGAGTATGGAGG - Intergenic
1137319556 16:47366908-47366930 AAATGATTGCTTGTTTATGGTGG - Intronic
1137538487 16:49345512-49345534 AAATGATGGGTAGTGCATGGTGG - Intergenic
1137568590 16:49550023-49550045 AAAAGATTGTCTGTGCATGGTGG - Intronic
1138198022 16:55068502-55068524 AAAGGAAGGTATCTGTGTGGGGG - Intergenic
1139012191 16:62647213-62647235 AAATAGTGGCATGGGTATGGAGG - Intergenic
1140015855 16:71183560-71183582 AAATGATGGTATGTAGAAGTCGG - Intronic
1140398067 16:74646459-74646481 AAAGCATGGTTGGTGTATGGTGG - Intronic
1144428857 17:15171994-15172016 AAATGGTGAAATGTGTATGAAGG - Intergenic
1144432607 17:15208566-15208588 AAATGATGGCAAGTTTGTGGAGG + Intergenic
1144730270 17:17522054-17522076 GAATGGGGGTATGTGAATGGGGG - Intronic
1145833427 17:27935928-27935950 AAATGTAGGTAAGTGTATGAAGG - Intergenic
1155644765 18:28064201-28064223 TAAACATGGTATCTGTATGGAGG + Intronic
1156285644 18:35692811-35692833 AAATGATGATATGTGTAGACAGG + Intronic
1156660209 18:39337633-39337655 AAATGCTGGAATGTGATTGGGGG + Intergenic
1156719689 18:40054769-40054791 AAATGTTGGTTTATGAATGGTGG - Intergenic
1156749610 18:40435820-40435842 GATTGTTGGTATGTGTTTGGAGG + Intergenic
1157233438 18:45940744-45940766 AAAAGATGGTATTTTGATGGTGG + Intronic
1158420441 18:57288305-57288327 AGATGATGGTATAAGTATAGGGG - Intergenic
1158966643 18:62627918-62627940 AGATGATGTTATGTATATGAAGG - Intergenic
1158974106 18:62694945-62694967 AAAAGATGGGCTGGGTATGGTGG - Intergenic
1159188141 18:65005887-65005909 AAAGTATGGCAGGTGTATGGAGG + Intergenic
1160001754 18:75031069-75031091 AACTGCTGCTATGTGTATGGGGG - Intronic
1163172783 19:15544119-15544141 AGATGAGGGTATCTGAATGGAGG - Intronic
926462738 2:13153162-13153184 AGATGATGATATGTAAATGGAGG + Intergenic
928443345 2:31311828-31311850 CAGTGAGGGTATGTGTTTGGGGG + Intergenic
928499590 2:31876380-31876402 AAATGATGGTAAATGATTGGAGG - Intronic
928712797 2:34026259-34026281 AAATGAAGGTATGTGCAGGAAGG - Intergenic
928867348 2:35933039-35933061 AAATGAGGGTGTGTATGTGGTGG - Intergenic
929327738 2:40637705-40637727 AAATGATGATATGTGTTTCATGG - Intergenic
930347670 2:50205312-50205334 AACTGATGGAATGTGTAAAGTGG + Intronic
934628984 2:95894405-95894427 AAATGATGATATTTTTATTGAGG - Intronic
935033794 2:99348070-99348092 AACTTAGGGTATGTGTATCGGGG + Intronic
935254611 2:101298535-101298557 AAATTACAGTATGTGTATGAAGG + Intronic
935681460 2:105641840-105641862 AAAAGATGGAATGTGCAAGGAGG + Intergenic
936462599 2:112723799-112723821 CAATGTGAGTATGTGTATGGAGG + Exonic
938015209 2:127861174-127861196 AAAAGATGAGATGTGTTTGGAGG - Intergenic
941122286 2:161544878-161544900 AAATCTTGATATGTATATGGAGG + Intronic
941194492 2:162431659-162431681 AAATGATGGTATGTGAAATGTGG + Intronic
941593952 2:167452475-167452497 CAGTGAGGGTGTGTGTATGGGGG + Intergenic
941658691 2:168171865-168171887 AAATAATGTTTTGTGTGTGGGGG - Intronic
943573651 2:189604894-189604916 AAAAAATGGTGTGTGTATGGTGG - Intergenic
943629394 2:190233868-190233890 AAATGTTGGGCTGGGTATGGTGG + Intronic
945146474 2:206743505-206743527 AAATGAAGCTATCAGTATGGTGG - Intronic
946544860 2:220728406-220728428 AATTGAAAGTCTGTGTATGGAGG - Intergenic
947270221 2:228326548-228326570 CAGTGAGGGTATGTGTTTGGGGG - Intergenic
947311177 2:228804437-228804459 AAATGATGTTATGGGGATGTAGG - Intergenic
1169577225 20:6978287-6978309 AAAGGATGGCATGTCTATAGTGG - Intergenic
1170529734 20:17278987-17279009 AAAGGATGGTATCTCTAGGGTGG - Intronic
1170806436 20:19636434-19636456 AAAAGAAGGTATGTCTAGGGAGG + Intronic
1172778132 20:37419993-37420015 TCATGATGGTTTGTGGATGGGGG - Intergenic
1173097182 20:40046178-40046200 AAATAATGTTATCTGTATAGTGG - Intergenic
1174151552 20:48489659-48489681 AAATGATGGTTATTGTAGGGAGG - Intergenic
1175616135 20:60400022-60400044 AAATGTTGGTAAGTATGTGGAGG - Intergenic
1177414011 21:20771177-20771199 GAATGATGGTATCTGTATTTGGG - Intergenic
1178103456 21:29294755-29294777 AAATGATGGTGTTTGTATCTAGG + Intronic
1183874459 22:40767055-40767077 AAATGAGGCTTTGTGTATGTTGG + Intergenic
950007057 3:9698203-9698225 TAGTGAAGGTAGGTGTATGGTGG + Intronic
950149304 3:10673912-10673934 AAATGATGGTATCAGGGTGGAGG + Intronic
951537126 3:23750443-23750465 AAATGATGGGCTGAGAATGGTGG + Intergenic
952463578 3:33555914-33555936 AAATGATTATATATGTATTGTGG - Intronic
952534322 3:34294336-34294358 CAATCTTGGTATGTGGATGGTGG + Intergenic
952543220 3:34389850-34389872 AAATATTGGTATGGGTATGGAGG + Intergenic
953720220 3:45348621-45348643 AAATGATGTTGTGGGTATGCTGG - Intergenic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
954977459 3:54709785-54709807 AAATGATGGCATGTGCCTGTGGG + Intronic
955643195 3:61109115-61109137 AAATGCTGTTAAGTGTATAGAGG + Intronic
955907716 3:63825136-63825158 AAATTATGGTGGATGTATGGTGG - Intronic
956751030 3:72344070-72344092 AAATGTGGGTAGGTGTATGGGGG - Intergenic
956824737 3:72987364-72987386 TATTGTTTGTATGTGTATGGAGG + Intronic
957109579 3:75935718-75935740 AAAAGATGTCTTGTGTATGGAGG - Intronic
957770120 3:84679700-84679722 TGATGATGGTATGTTTCTGGAGG + Intergenic
958435464 3:94090546-94090568 ATTGGATGGTATGTGTATAGAGG + Intronic
960927218 3:122806661-122806683 AAATGATGGGCTGGGCATGGTGG - Intronic
961241424 3:125415173-125415195 AAATCATGGTATGTCTGTGAAGG - Intergenic
961871390 3:129991061-129991083 ATATGATGGGATGTCAATGGGGG + Intergenic
962437275 3:135378750-135378772 AATTGAAGGAATGTGTTTGGAGG + Intergenic
964847368 3:161058410-161058432 AAATGATGGGCTGGGTGTGGTGG - Intronic
967373493 3:188774865-188774887 AAGTGATAGTATGTGTATATGGG - Intronic
969935142 4:10672968-10672990 AAATAATTCTAAGTGTATGGAGG - Intronic
970826816 4:20286282-20286304 AAATGATGGGATGAGGGTGGGGG - Intronic
970868402 4:20784674-20784696 AAGTTATGGAATGTGTAGGGTGG + Intronic
970894352 4:21085118-21085140 ATATGATGGTATGTGGAGGTGGG + Intronic
971353085 4:25870085-25870107 ACATGCTGGTAGCTGTATGGTGG - Intronic
972082066 4:35165261-35165283 AAATGATCGTATGTGGAATGGGG - Intergenic
972831592 4:42820211-42820233 AAATGTTGATATGTCTAAGGAGG + Intergenic
972838047 4:42899044-42899066 CAAGGATGGTATGTGCAAGGTGG - Intronic
975084068 4:70316271-70316293 AAGTGATGGTTTGTGTTTGATGG - Intergenic
975463055 4:74677029-74677051 AAATGATGGCATGGATATGTAGG - Intergenic
976527092 4:86105884-86105906 AAATGCTGGTCAGTGTATGGTGG - Intronic
976810640 4:89096855-89096877 ATATGATGGTATATATATGATGG + Intronic
978712993 4:111808249-111808271 AATTGAAAGTATGTGTGTGGGGG - Intergenic
979700959 4:123667353-123667375 AACAGATGGTATGTATTTGGAGG - Intergenic
980637078 4:135520303-135520325 AAATTATGATATTTGTGTGGAGG - Intergenic
980992120 4:139747151-139747173 AAATGATGGTTTCTGTAGGGTGG + Intronic
982437877 4:155399068-155399090 AGATGATGCTAGGTGTACGGAGG + Intergenic
982613532 4:157610167-157610189 AAATGATGTTCTGTTTATAGAGG - Intergenic
984521683 4:180809794-180809816 AACAGAGGGTATGTGTGTGGTGG - Intergenic
984727504 4:183035794-183035816 GCATCATGGCATGTGTATGGGGG - Intergenic
987612899 5:20230600-20230622 AAATGAAGGTATGTATGTGATGG - Intronic
987728416 5:21734516-21734538 TAATTATGGTGTGTGTATGGGGG + Intergenic
988582530 5:32480522-32480544 ACATCATGGTGTGTGTGTGGGGG + Intergenic
988635293 5:32977385-32977407 AGATGATGGAATATGTGTGGTGG - Intergenic
988921960 5:35951377-35951399 AAAGGAAAGTATGTGTATGGGGG - Exonic
990089922 5:52030287-52030309 AAAAAATGGTATGTCTATGTAGG + Intronic
991227149 5:64286104-64286126 CATTGAGGGTAAGTGTATGGAGG - Intronic
992582048 5:78189290-78189312 ATATGATGGTATGTTCATAGAGG - Intronic
994542659 5:101120668-101120690 ATCTGATGGTTTGTGTATTGGGG - Intergenic
994554456 5:101280392-101280414 AAGTGATGGTAGGTGTTTTGAGG - Intergenic
995109203 5:108409688-108409710 AAATGATGGTATGGGAGTGAAGG + Intergenic
997749111 5:136327573-136327595 AAAGGAAGGTATGAGGATGGAGG + Intronic
997872721 5:137519424-137519446 AAAGTATGGTAGGTGAATGGTGG + Intronic
999910462 5:156192459-156192481 AAAGGCTGGGAAGTGTATGGGGG + Intronic
1001541015 5:172539424-172539446 AGATGATGGTATTTGGAGGGGGG + Intergenic
1003008518 6:2404550-2404572 TAGTGATGGTTTGGGTATGGTGG - Intergenic
1005574370 6:27178170-27178192 AAAGGAGTGTATGTGTGTGGTGG - Intergenic
1008370319 6:50723834-50723856 ATATTAGGGTGTGTGTATGGCGG - Intronic
1008869819 6:56260055-56260077 AAAACATGCTATGTGTGTGGTGG - Intronic
1008876349 6:56333756-56333778 AAGTGATGGCAAGGGTATGGAGG - Intronic
1011153044 6:84296944-84296966 CAATGATGATATGTGTTTTGTGG + Intergenic
1013427076 6:110022238-110022260 AAATGATGATTTTTGTATGCTGG + Intergenic
1013839879 6:114378645-114378667 ACAGGATGATATGTGTTTGGTGG - Intergenic
1018010260 6:159663404-159663426 ATATGATGGTATATATATGATGG - Intergenic
1018010262 6:159663434-159663456 ATATGATGGTATATATATGATGG - Intergenic
1018880166 6:167869814-167869836 AAGTGATGGTAACTTTATGGTGG + Intronic
1020345562 7:7159166-7159188 AAATGATTGTATGCTTTTGGAGG + Intronic
1020428022 7:8091725-8091747 AAATAATGGGATGTGTATGGGGG - Intronic
1020921186 7:14266631-14266653 AAATAATGGTAGGTGTATTTTGG - Intronic
1026193926 7:68155699-68155721 AAATTATGGCATGGGGATGGGGG - Intergenic
1027612957 7:80385197-80385219 AAATAATGGAAAGTGTATTGTGG - Intronic
1027994813 7:85412409-85412431 AACTAATGGTTTGTGTCTGGAGG + Intergenic
1031749029 7:125546930-125546952 ATATGATGGTATCTGTAGGTTGG + Intergenic
1032558893 7:132867009-132867031 AAATGATGGTATGTGTATGGTGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034098109 7:148427720-148427742 AACTGATGATATGTGTCTTGGGG - Intergenic
1036938739 8:13031221-13031243 AAATGATTGTTTGTTTCTGGAGG - Intronic
1037158857 8:15742209-15742231 AGTCTATGGTATGTGTATGGTGG + Intronic
1037651769 8:20845615-20845637 CAATGATGGTATGTGGAGGTGGG - Intergenic
1038503809 8:28067313-28067335 AATTTTTGGTATGTGAATGGAGG - Intronic
1042953038 8:74220613-74220635 AGCTGAGGGTATGTGTGTGGTGG + Intergenic
1043003805 8:74792886-74792908 AGATGTTGGTATGTTTCTGGTGG + Intronic
1045049617 8:98310872-98310894 AAATGATATTCTGGGTATGGTGG - Intergenic
1045344816 8:101284464-101284486 AAATCATGGTGTGTGTGTTGGGG - Intergenic
1048528932 8:135229746-135229768 ACATGAGGGTTTGTGTATGAGGG + Intergenic
1050093420 9:2039176-2039198 AAATGATGTTTTGGGTATGTTGG + Intronic
1050207707 9:3214576-3214598 AAAGAATGGTATATGTATGCTGG - Intergenic
1050579537 9:7037212-7037234 AAATGAGGGTGTGTTTGTGGGGG + Intronic
1050870216 9:10558448-10558470 ACATGATGAAATGTGTATGAAGG - Intronic
1051523161 9:18012974-18012996 AAATGCTGGTAAGTAAATGGTGG - Intergenic
1051742947 9:20268842-20268864 AATAAATGGTATGTGTGTGGAGG + Intergenic
1051906836 9:22105145-22105167 AAATGAGGGTATGTGTATACTGG + Intergenic
1052586716 9:30438795-30438817 CAATTATGCTATGTGTATGTTGG - Intergenic
1052781709 9:32788208-32788230 AAATGATGTTATGGGTACAGAGG - Intergenic
1052869872 9:33494031-33494053 ACGTGATGGTATGTGTATGTGGG + Intergenic
1053492501 9:38519951-38519973 ACATTATGGTAGGTGTATAGTGG - Intergenic
1053553972 9:39115488-39115510 AAATGTGGGGGTGTGTATGGGGG - Intronic
1053818076 9:41935614-41935636 AAATGTGGGGGTGTGTATGGGGG - Intronic
1054108339 9:61079272-61079294 AAATGTGGGGGTGTGTATGGGGG - Intergenic
1054612518 9:67251853-67251875 AAATGTGGGGGTGTGTATGGGGG + Intergenic
1054750222 9:68898007-68898029 AGAAGATGGTATGTGTCAGGAGG - Intronic
1054995062 9:71377321-71377343 AAATGATTGTGTTTGGATGGTGG - Intronic
1056332463 9:85532524-85532546 ACTTGATGATTTGTGTATGGAGG - Intergenic
1056748972 9:89331579-89331601 TAATGACGCTATGTGTATGGGGG - Intronic
1056927961 9:90850691-90850713 AAATGCTGGCATCTGAATGGTGG - Intronic
1057337812 9:94170096-94170118 AAATAATGGTATATGTATAATGG + Intergenic
1057672739 9:97108886-97108908 ACATGATGGTAGGTGTATAGTGG - Intergenic
1057688517 9:97261027-97261049 AAGTGATGGTATGTGTATGTGGG - Intergenic
1059617413 9:115966464-115966486 ACATGATGGTATCTGTTTTGGGG + Intergenic
1060862399 9:126965494-126965516 AACTGAAGGTATGTGTTTTGGGG + Intronic
1186208401 X:7224450-7224472 AGATGATGGTATTTGGATGAGGG + Intronic
1186736003 X:12464646-12464668 AAATGATGGTATATACATGACGG + Intronic
1187834311 X:23415674-23415696 AAAGGATGGAGTGTGGATGGTGG - Intergenic
1188279605 X:28248673-28248695 ACATAATAGTATGTGTATGCAGG + Intergenic
1189719519 X:43901195-43901217 AAACCATGGTGTGTGTGTGGTGG - Intergenic
1191661129 X:63652443-63652465 AAATGATTGAAAGTATATGGAGG + Intronic
1193202988 X:78714532-78714554 CAGTGATGATATGTGTTTGGAGG - Intergenic
1193541372 X:82776039-82776061 CAGTGAGGGTATGTGTTTGGGGG + Intergenic
1194796281 X:98214893-98214915 TAAGGATGGTAGGTGTGTGGAGG - Intergenic
1196588362 X:117457000-117457022 ACATCCTGGTATGTGTACGGAGG + Intergenic
1196999624 X:121424413-121424435 AAATAATGGTATATTTATGCTGG + Intergenic
1197632088 X:128872936-128872958 AAACCCTGGTATGTTTATGGTGG - Intergenic
1198316451 X:135471533-135471555 AAATGAGGATATGTTCATGGTGG - Intergenic