ID: 1032562766

View in Genome Browser
Species Human (GRCh38)
Location 7:132909637-132909659
Sequence CTTCACAGTGGAGCACAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032562762_1032562766 -4 Left 1032562762 7:132909618-132909640 CCAAAATTATCACTCCCAACTTC 0: 1
1: 0
2: 27
3: 407
4: 2459
Right 1032562766 7:132909637-132909659 CTTCACAGTGGAGCACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032562766 Original CRISPR CTTCACAGTGGAGCACAATG AGG Intronic
No off target data available for this crispr