ID: 1032563020

View in Genome Browser
Species Human (GRCh38)
Location 7:132912300-132912322
Sequence TCTGGTTAGTAACTGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032563020 Original CRISPR TCTGGTTAGTAACTGTTGCC TGG Intronic
912905713 1:113704588-113704610 TCTACTGAGTAACTGCTGCCAGG + Intronic
913484494 1:119321466-119321488 TCTGTGTAGTAACTATTGTCAGG - Intergenic
917430670 1:174965056-174965078 TTTGGTTAGTAACTTTTGGGAGG - Intronic
918861032 1:189826473-189826495 TCTGGTTAAGAACTATTGCTGGG - Intergenic
920060008 1:203220836-203220858 TCTGGTTAGAACCTGTCCCCGGG + Intronic
921625776 1:217376318-217376340 TTTGGGGAGGAACTGTTGCCTGG - Intergenic
1063168793 10:3487313-3487335 TCTGGTGAGTATCTGCTTCCTGG - Intergenic
1067096782 10:43306755-43306777 TCTGGTTAATAACTGTTATATGG + Intergenic
1068587956 10:58821409-58821431 TCTGATTAGTGAATGTTGTCTGG - Intronic
1069109536 10:64428313-64428335 TCTGGTGAGGAACTGCTTCCTGG - Intergenic
1070580056 10:77712103-77712125 GATGGTTAGGAACTCTTGCCTGG + Intergenic
1071846408 10:89525675-89525697 TTAAGTTAGTAGCTGTTGCCAGG + Intronic
1074683669 10:115937268-115937290 TCTGGTTATAAAATTTTGCCTGG - Intronic
1084868347 11:72078957-72078979 TCTCTCTAGTATCTGTTGCCTGG - Intronic
1085909321 11:80802701-80802723 TCTGTTTAGTAAATGGTGCTGGG + Intergenic
1088077311 11:105866642-105866664 TATGGTTAGTAACTCCTGTCTGG + Intronic
1089178298 11:116563884-116563906 TCTGGTTGGTACCTCTTGGCAGG - Intergenic
1091794486 12:3289908-3289930 TGCGGTTAGCACCTGTTGCCCGG + Intergenic
1093201203 12:16188314-16188336 TCTGTTTAGCAATTGTTTCCTGG - Intergenic
1094787280 12:33863386-33863408 TCTGGTCAGTAAGTTTTTCCAGG + Intergenic
1095238899 12:39833671-39833693 GCTGGATACTCACTGTTGCCAGG + Intronic
1095529898 12:43174694-43174716 TCTTGTTAGAGACTGATGCCTGG + Intergenic
1100506158 12:95222377-95222399 TCTGTTCAGTAAATGGTGCCAGG - Intronic
1104583945 12:130031919-130031941 AGTGATTAGTAACTGTGGCCAGG - Intergenic
1107757103 13:43636330-43636352 TCTGGTTAATAACTGTTTCATGG + Intronic
1108525512 13:51282710-51282732 GATGGTTGGTAACTGCTGCCTGG - Intronic
1113559712 13:111268885-111268907 CCTGGATAGTTACTGTTTCCTGG + Intronic
1114928085 14:27430758-27430780 CCTCGTTAGAAACTATTGCCAGG + Intergenic
1116418122 14:44702893-44702915 TCTTGTTAGAAACTGATGCTAGG + Intergenic
1118666308 14:68074543-68074565 TCTGGTTAGGAACCATTGCTGGG + Intronic
1119376374 14:74197239-74197261 TCTGCTGAGTAAGTGTTGACTGG - Intronic
1120934434 14:89880287-89880309 TCTGGTTAGGGCCTGTTCCCTGG - Intronic
1121243986 14:92449685-92449707 TCGGGCTGGGAACTGTTGCCCGG + Intronic
1127097344 15:55526357-55526379 TCTGGTTAAGAACTATTGCTGGG + Intergenic
1128162496 15:65433038-65433060 TCTAGTTAGTACCTGTTGAGTGG - Intergenic
1128405462 15:67333007-67333029 TCTGGTGAGGACCTGTTTCCTGG + Intronic
1130210393 15:81916961-81916983 TTTTGTCAGAAACTGTTGCCGGG + Intergenic
1137323746 16:47412238-47412260 TCTGGTTAAGAAGTGTTGCTGGG - Intronic
1139137896 16:64226673-64226695 TCTGGTTAGGACCTGTTCCATGG - Intergenic
1139902043 16:70335741-70335763 CCTGATTAATAACTGTTGGCTGG - Intronic
1140721457 16:77775947-77775969 TCTGGTGAGGATCTGTTACCTGG - Intergenic
1140730412 16:77851149-77851171 ACGGGCTAGTATCTGTTGCCGGG - Intronic
1140859618 16:79007464-79007486 GATTGTTAGTAACTGTTGCAAGG + Intronic
1141741656 16:85897476-85897498 TCTGGTTAGAAATTGTTCCTAGG + Intergenic
1142103589 16:88289877-88289899 TCTGGTTAGGCAATGTTGCAAGG - Intergenic
1143801220 17:9383104-9383126 TCTGGTGAGGATCTGTTTCCTGG - Intronic
1145812676 17:27773967-27773989 TCTGCTGAGTGACTGTTGCCGGG + Intronic
1148290603 17:46444702-46444724 TCTGCTGAGTAACTTCTGCCAGG + Intergenic
1148312794 17:46662407-46662429 TCTGCTGAGTAACTTCTGCCAGG + Intronic
1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG + Intronic
1149247573 17:54728713-54728735 TCTGATTAAGAACTGTTGCTGGG - Intergenic
1151116400 17:71740231-71740253 CCTGGTTTATACCTGTTGCCTGG - Intergenic
1153442580 18:5137027-5137049 TCTGGTGAGGAAATTTTGCCAGG - Intergenic
1157122436 18:44924185-44924207 TCTAGTTAATAAATGATGCCAGG + Intronic
1159097489 18:63920757-63920779 TGTGGTTGGTCACTCTTGCCTGG - Intronic
1164884856 19:31769868-31769890 TTTCGTTAGTATCTGTTCCCAGG - Intergenic
1165659420 19:37562845-37562867 TCTGGTAATTAACTGTTAACTGG + Exonic
1167772003 19:51526671-51526693 TCTGGTTAAGAACTTTTGCTGGG - Intronic
1168606054 19:57760714-57760736 TCTGGTTAGGAACTACTGCTGGG - Intergenic
926519217 2:13889251-13889273 TCTGGTTATTAATCCTTGCCAGG - Intergenic
928164394 2:28959144-28959166 TCGGGTTAGCATCTGTAGCCCGG - Intronic
930194838 2:48498941-48498963 TCTGGTTAGGGTCTGTTTCCTGG + Intronic
930505708 2:52280946-52280968 TCTGGTGAGGACCTGTTTCCTGG + Intergenic
931549394 2:63425355-63425377 TCTGGTAAAGAACTGTTGCTAGG - Intronic
934720088 2:96568080-96568102 TGTGGTAAGGAACTATTGCCGGG + Intergenic
938811101 2:134853386-134853408 TCTGGATAGTAATAGTTGCATGG + Intronic
940769597 2:157826011-157826033 TCCGTGTTGTAACTGTTGCCTGG + Intronic
942908299 2:181209257-181209279 TCTGGTTAACAACTATTGCTGGG - Intergenic
945334572 2:208577385-208577407 TCTGTTTAGTAAATGGTGCTGGG + Intronic
947462152 2:230312974-230312996 TCTGGGTAATAAATGTTGTCTGG - Exonic
1170766375 20:19292852-19292874 TCTGGTGAGGACCTGTTTCCTGG + Intronic
1176688258 21:9874102-9874124 TCTGGTTAACAGCTGTTGCTGGG - Intergenic
1177157538 21:17513750-17513772 TCTGGTTAGCAGCTCCTGCCTGG - Intronic
1180061875 21:45389687-45389709 TCTAGTTAGAAAATGTGGCCGGG - Intergenic
1181712716 22:24700726-24700748 TCTGGTTTATAATTGTTGCTGGG - Intergenic
1184278364 22:43423326-43423348 TCTTGTCTGTAACTGCTGCCCGG - Intronic
1185114886 22:48927029-48927051 TCTTGTTATTAACATTTGCCGGG - Intergenic
949251486 3:1989845-1989867 TCTGGTGTGTAACTTTTGACTGG - Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
954139686 3:48598502-48598524 TTTGGTTTCTAACTGCTGCCTGG - Intergenic
954284886 3:49611873-49611895 TCTGGGTAGTGACTCTGGCCTGG + Intronic
955515643 3:59723982-59724004 TCTGGTGAGCACCTGTTTCCTGG + Intergenic
959911024 3:111763813-111763835 TCTGGTGAGGGACTGTTTCCTGG - Intronic
962088162 3:132213779-132213801 TCTGGTTAGTAGGTCTTGGCAGG - Intronic
965555180 3:170011226-170011248 TCTGTTAAGAAACTGTAGCCAGG - Intergenic
970483024 4:16496730-16496752 GCTGGATGGTAACAGTTGCCTGG - Intergenic
972118511 4:35669434-35669456 TCTGGTGAGAAATTGTTTCCAGG - Intergenic
972140810 4:35957328-35957350 TCTGGTTAGGATCTATTGCTGGG + Intronic
972215206 4:36890489-36890511 TCTGGTTAAGAACTATTGCTGGG + Intergenic
972709891 4:41584925-41584947 TCTGGTGAGGACCTGTTTCCTGG + Intronic
973904944 4:55519435-55519457 TCTGGTTAATAACTATAGTCAGG - Intronic
974601335 4:64084639-64084661 TCTGGTTAGGACTTGTTTCCTGG - Intergenic
977053831 4:92163936-92163958 TGTGGTTAGGATCTATTGCCAGG - Intergenic
977174730 4:93806507-93806529 TCTGGTTTTTGACAGTTGCCTGG + Intergenic
978249982 4:106619135-106619157 TCTTCTTAGTCACTGTTGGCAGG - Intergenic
978467644 4:109026491-109026513 TCTGGTTATTAACGACTGCCTGG + Intronic
980351633 4:131691932-131691954 TCTGGTTAACAGCTGTTGCTGGG - Intergenic
980685204 4:136219190-136219212 CCTGGTTAGGAACTTTTGCTGGG + Intergenic
982590363 4:157301569-157301591 ACTGTTTAGTAACTGTTGTACGG - Intronic
983198953 4:164840064-164840086 TGTGGCTAGTAGCTGTTGTCTGG + Intergenic
983303287 4:165954939-165954961 TCTGGTTAGGAACCATTGCTGGG - Intronic
984044099 4:174776086-174776108 TCTGTTGAGCAACGGTTGCCTGG + Intronic
985200329 4:187478020-187478042 GCTTGTTAGTAAGTGTTGCAAGG + Intergenic
985962306 5:3311847-3311869 TCTACTTAGTAACAGTTGCTAGG + Intergenic
986246075 5:6008075-6008097 TCTGGTTAGGCACTGCTCCCAGG + Intergenic
987765534 5:22224011-22224033 TCTGCTGAGTAGCTGTTGGCAGG - Intronic
989492221 5:42071267-42071289 TTTAGTTGGTAACTGATGCCTGG + Intergenic
992454201 5:76901574-76901596 ACTGGTTTGTAAATGCTGCCTGG + Intronic
993246289 5:85457819-85457841 TCTGGTTAGGAACTATTGCTGGG + Intergenic
998591398 5:143482510-143482532 ACTGGTTGGTAACAGCTGCCTGG - Intergenic
1000387169 5:160685786-160685808 ACTGGTTAATAATTGTTCCCCGG + Intronic
1001164019 5:169347118-169347140 TCTGTCTAGTAGCTGGTGCCTGG + Intergenic
1002806916 6:586205-586227 TCTGGTTATTTTCTGATGCCCGG - Intronic
1003700725 6:8462091-8462113 TCTGGTTAAGAACTATTGCCTGG + Intergenic
1015258956 6:131212469-131212491 TTTGGTTTGGAACTGTTCCCTGG - Intronic
1016544060 6:145200969-145200991 TATGGTTCGTAAATGTTGTCCGG + Intergenic
1018147059 6:160901163-160901185 TCTGGTTAGGAACCATTGCTGGG - Intergenic
1018913687 6:168119500-168119522 TCTGGTCAGTAAGTTTTCCCAGG + Intergenic
1020987542 7:15155649-15155671 TCTGGTTAAAAACCATTGCCGGG + Intergenic
1021888044 7:25159274-25159296 TCATGATAGTAAATGTTGCCCGG + Intronic
1025625507 7:63217812-63217834 TCTGGTTGGTCAATGTTGGCTGG - Intergenic
1027506015 7:79017560-79017582 CCTAGTTAGGAACTGTTGCTGGG - Intronic
1028098479 7:86791529-86791551 GCTGGTTAGTAACAGGGGCCAGG + Intronic
1029212307 7:98919067-98919089 TCTGGTTGGTAATTGTTGGAGGG + Intronic
1030149139 7:106385392-106385414 TATTGTGAGTAACTGTTGCAGGG + Intergenic
1031294507 7:119984279-119984301 CCTGGTTAATAACTATTGCTAGG - Intergenic
1032563020 7:132912300-132912322 TCTGGTTAGTAACTGTTGCCTGG + Intronic
1033522935 7:142181052-142181074 TCTGGTTAGAAACCATTGCTGGG + Intronic
1038969341 8:32614579-32614601 TCTGGTTAGTAAAATTTGCCAGG - Intronic
1039297377 8:36171073-36171095 TTTTTTTAGTATCTGTTGCCTGG + Intergenic
1046571060 8:115966717-115966739 GTTGATTTGTAACTGTTGCCTGG + Intergenic
1047212653 8:122852545-122852567 TTTGGTTAGGAACTGTCCCCAGG - Intronic
1049318184 8:141980808-141980830 TCTGCTTAGTGCCTGTAGCCAGG - Intergenic
1051156226 9:14149786-14149808 TCTGGTTTATAACTGATTCCTGG - Intronic
1051800259 9:20924809-20924831 TTTCATTAGTACCTGTTGCCTGG - Intronic
1053781080 9:41607783-41607805 TCTGGTTAACAGCTGTTGCTGGG + Intergenic
1054169026 9:61817936-61817958 TCTGGTTAACAGCTGTTGCTGGG + Intergenic
1054668506 9:67762880-67762902 TCTGGTTAACAGCTGTTGCTGGG - Intergenic
1061843211 9:133372272-133372294 TCTGGTTAGTTTCTGCTGGCAGG - Intronic
1187263549 X:17709720-17709742 TCTGGAGAGTAACCGTGGCCTGG + Intronic
1189583787 X:42435840-42435862 CCTGGTTAAGAACTGTTGCTGGG - Intergenic
1190970583 X:55343612-55343634 TCTGGTTAGGATCCGTTGCTAGG - Intergenic
1194434607 X:93855328-93855350 TCTGGTTAAGAACTATTGCTGGG + Intergenic
1195155300 X:102116549-102116571 TCTGGTTAATAACCATTGCTAGG - Intergenic
1199640890 X:149859651-149859673 CCTGGTTAGGAACTATTGCTGGG - Intergenic