ID: 1032564301

View in Genome Browser
Species Human (GRCh38)
Location 7:132925822-132925844
Sequence CGTTTTTGAGGCTCATCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032564301_1032564310 17 Left 1032564301 7:132925822-132925844 CCAAAAGATGAGCCTCAAAAACG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1032564310 7:132925862-132925884 AATGCAAATGTATATTCACAAGG 0: 1
1: 1
2: 3
3: 42
4: 385
1032564301_1032564307 -10 Left 1032564301 7:132925822-132925844 CCAAAAGATGAGCCTCAAAAACG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1032564307 7:132925835-132925857 CTCAAAAACGAGTTGGGGATGGG No data
1032564301_1032564308 -9 Left 1032564301 7:132925822-132925844 CCAAAAGATGAGCCTCAAAAACG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1032564308 7:132925836-132925858 TCAAAAACGAGTTGGGGATGGGG No data
1032564301_1032564311 22 Left 1032564301 7:132925822-132925844 CCAAAAGATGAGCCTCAAAAACG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1032564311 7:132925867-132925889 AAATGTATATTCACAAGGAAAGG 0: 1
1: 0
2: 4
3: 43
4: 462
1032564301_1032564309 -8 Left 1032564301 7:132925822-132925844 CCAAAAGATGAGCCTCAAAAACG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1032564309 7:132925837-132925859 CAAAAACGAGTTGGGGATGGGGG 0: 1
1: 3
2: 49
3: 2400
4: 34733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032564301 Original CRISPR CGTTTTTGAGGCTCATCTTT TGG (reversed) Intronic
903005307 1:20294334-20294356 AGTTTTGCAGGCTCATCCTTGGG - Intronic
904947084 1:34207165-34207187 GGGTTTTGAGCCTCATCTTAAGG + Intronic
906749910 1:48249558-48249580 GGTGTTAGGGGCTCATCTTTGGG - Intergenic
910537040 1:88310189-88310211 AGTTTTTAAGGTTCATCATTAGG - Intergenic
912043717 1:105426120-105426142 CTTTTCTGAGGCTCTTCTTTAGG + Intergenic
912330283 1:108814039-108814061 CCTTTTTTGGGCTCATTTTTTGG - Intergenic
915398200 1:155602062-155602084 CTTTTTTTAAGCTCATCTTTGGG + Intergenic
915414169 1:155727597-155727619 TTTTTTTAAAGCTCATCTTTGGG + Exonic
916481604 1:165219374-165219396 CATTTATGAGGCTCATCTCTGGG - Intronic
917057670 1:171001635-171001657 ATTTATTGAGGCTCATTTTTTGG + Intronic
923237953 1:232052807-232052829 CATTTTTGGAGCTCCTCTTTTGG - Intergenic
923252922 1:232193781-232193803 CCTTTTGCAGGATCATCTTTAGG + Intergenic
1063595988 10:7436126-7436148 CTCTTCTTAGGCTCATCTTTCGG - Intergenic
1064632487 10:17331008-17331030 CGTTTATGTGGCTCATCTTTGGG - Intronic
1065252226 10:23827293-23827315 AGTTTTTCAGGCTCTTCCTTAGG - Intronic
1066744793 10:38597193-38597215 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1066956040 10:42173652-42173674 TGTTTATGAGGCTTATGTTTGGG - Intergenic
1069902823 10:71715752-71715774 CTCTTCTGAGGATCATCTTTGGG + Exonic
1072808783 10:98444079-98444101 GGGCTTTGAGGCTCATCTTCTGG - Intronic
1073509089 10:104031858-104031880 CGTTTTCTGGGCTCATATTTAGG + Exonic
1074150587 10:110756105-110756127 GGTTTGTGAGTCCCATCTTTGGG + Intronic
1075759753 10:124846873-124846895 CCTTTCTGAGCCTCATCTATAGG + Intergenic
1076756944 10:132577508-132577530 CTGTCTTGAGGCCCATCTTTTGG + Intronic
1078279869 11:9890697-9890719 CTTCTTTGAGGCACATCTGTTGG - Intronic
1087530126 11:99370295-99370317 TGTTTTTGAAAATCATCTTTTGG + Intronic
1088706737 11:112470757-112470779 CGTTTTTGAGTCTCATGACTAGG - Intergenic
1089597424 11:119589719-119589741 TGTTTTTGAGGCTGTTGTTTTGG - Intergenic
1091890885 12:4053381-4053403 TCTTTTTGTTGCTCATCTTTGGG + Intergenic
1092349859 12:7747320-7747342 CGGTCTTGAGGCTCTTCTTCAGG + Exonic
1093256324 12:16872637-16872659 AATTTTTCAGGCTCCTCTTTAGG + Intergenic
1093389828 12:18604644-18604666 CTTTATTGAGGCTCATTTTATGG - Intronic
1093488478 12:19679036-19679058 CTTTATTGAGGCTCATTTTGTGG + Intronic
1099637282 12:85229871-85229893 TATTTTTGTGGCTCATCTGTTGG - Intronic
1099638179 12:85243852-85243874 AGTCTTTGTGGCTCATCTTATGG + Intronic
1101559554 12:105843421-105843443 AGTGTTTGAGACTCATCTGTTGG + Intergenic
1109661885 13:65470715-65470737 TATTTTAGAGACTCATCTTTTGG + Intergenic
1114539770 14:23446368-23446390 CCTTCCTGAGGCTCACCTTTGGG - Intergenic
1116345461 14:43786972-43786994 CATTTTTGCTGCTCTTCTTTTGG + Intergenic
1202936956 14_KI270725v1_random:97731-97753 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1123392919 15:19895465-19895487 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1128566875 15:68706487-68706509 AGTTAATGAGGCTCAACTTTTGG + Intronic
1130331119 15:82923076-82923098 TGTTATTCAGGCTCATCTTTGGG + Intronic
1131572012 15:93548058-93548080 GATTTTTGAGACTCTTCTTTGGG + Intergenic
1134144747 16:11751394-11751416 CTTTGTTGAGCTTCATCTTTAGG + Exonic
1135686725 16:24503754-24503776 GGTCTTTGAGACACATCTTTTGG - Intergenic
1136901705 16:34046704-34046726 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1139874738 16:70136591-70136613 TGTTTTTGCAACTCATCTTTTGG + Intronic
1140361047 16:74344552-74344574 TGTTTTTGCAACTCATCTTTTGG - Intergenic
1141262687 16:82468174-82468196 AGGTTTTGGGGATCATCTTTGGG + Intergenic
1141940662 16:87273975-87273997 CCTCTCTGAGGCTCATCTGTAGG - Intronic
1142433356 16:90042427-90042449 GGAGTTTGAGACTCATCTTTTGG - Intronic
1150621672 17:66812389-66812411 CGTTTTTGAGCATCCACTTTGGG - Intergenic
1152312799 17:79561111-79561133 AGATTTTGAGACTCCTCTTTTGG - Intergenic
1154518660 18:15201696-15201718 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1157212631 18:45757069-45757091 TGTTTCTGAGGCTGTTCTTTAGG - Intergenic
1157218822 18:45809470-45809492 CTTTATTGAGGCTCATTTTGTGG - Intergenic
1158807874 18:60997165-60997187 CGTCTTTGAGGCTTATTTCTGGG - Intergenic
1161152566 19:2717275-2717297 CGATGTTGAGGCTCATGTTCCGG + Exonic
1167017012 19:46847735-46847757 CGTTTTCCAGGCTCATCTGTGGG + Intronic
1167124795 19:47542081-47542103 CGTTTTCCAGGCTCATCCGTGGG - Intronic
1167759059 19:51432513-51432535 TGCTTTTGAGGCTCATCTATGGG + Intergenic
1167784958 19:51629144-51629166 GGTTTCTGTGGCTCCTCTTTGGG - Intronic
1167826177 19:51975523-51975545 TGTTTTTGATTCTCTTCTTTTGG - Intronic
931683584 2:64773032-64773054 GGTTTTGGGGGCTCATTTTTAGG - Intergenic
934189296 2:89771433-89771455 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
934303964 2:91805594-91805616 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
934329290 2:92047156-92047178 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
934467509 2:94277077-94277099 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
938518652 2:132042187-132042209 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
941001858 2:160210328-160210350 CATGTTTGAGGCACATCCTTGGG + Intronic
941418631 2:165254390-165254412 CATTTTTGAGGGTGTTCTTTCGG + Intronic
941541221 2:166787449-166787471 TATATTTGAGGCTCATCTCTAGG - Intergenic
942815136 2:180044349-180044371 TTTTTTTGAGACTCATCTTGTGG + Intergenic
942875686 2:180793957-180793979 CGTTTTTGAGTCTAAACTATAGG - Intergenic
944795516 2:203180550-203180572 CATTTTTGAGGCTCCTCCATTGG - Intronic
946915292 2:224513547-224513569 AGATTTTGAGGCTCCTTTTTTGG - Exonic
947139743 2:227009821-227009843 TTATTTTGAGGGTCATCTTTTGG - Intronic
947320526 2:228912729-228912751 CAATATTGAGACTCATCTTTTGG - Intronic
948521583 2:238542264-238542286 GGTTTTTTAGGATCATCCTTAGG - Intergenic
1169586255 20:7089391-7089413 CGTTTTTGAGATTCACCCTTGGG - Intergenic
1169705471 20:8498717-8498739 CTTTGTTTAGGCTCATGTTTCGG + Intronic
1169784646 20:9346518-9346540 AGTTTTTGAGGCTCAAATGTGGG + Intronic
1170546778 20:17441243-17441265 GGTTTTGGAGGCTCATCTTGGGG - Intronic
1173261543 20:41440704-41440726 CCTTTTTGAGGCCCCTCTTCTGG - Intronic
1175027773 20:55921067-55921089 CTTTTTTAAGCCTCATATTTAGG - Intergenic
1176586361 21:8591246-8591268 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1176743065 21:10623966-10623988 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1177174207 21:17686931-17686953 ATTTTTTGAGGCTCATTTTATGG + Intergenic
1180269167 22:10568149-10568171 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1180281006 22:10695428-10695450 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1180534294 22:16383307-16383329 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1183209992 22:36445144-36445166 CGTTTCTGAGTCTCAGGTTTAGG - Intergenic
1203238090 22_KI270732v1_random:26893-26915 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1203315349 22_KI270737v1_random:2489-2511 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
949680891 3:6513281-6513303 ATTTTATGAGGCACATCTTTTGG + Intergenic
954850658 3:53597227-53597249 TCTTTTTGAAGCTTATCTTTAGG + Intronic
954970712 3:54649574-54649596 TCTTTTTGAGGCCCCTCTTTTGG + Intronic
955048176 3:55379921-55379943 AGTTTTTGAGGCTCACTTTGTGG - Intergenic
960616366 3:119599544-119599566 CTTTTTGGAAGCTCATCTGTCGG + Intronic
965133597 3:164733419-164733441 CTTTTTTGTGTCTCTTCTTTTGG + Intergenic
966117455 3:176482889-176482911 ATTTTTTGAGGCTCATTTTATGG + Intergenic
966761365 3:183422108-183422130 AGTTTTTGAGGCCAATCTTTAGG + Intronic
967342893 3:188420543-188420565 CGTTTTTGAGATTCATATTTTGG + Intronic
967479542 3:189957907-189957929 CATTTTTATAGCTCATCTTTAGG + Exonic
969153218 4:5187847-5187869 TATTTTTGAGGCTTAGCTTTGGG - Intronic
975743520 4:77453537-77453559 AGTTTTGCAGGCTTATCTTTTGG + Intergenic
979797268 4:124861820-124861842 CATTTTTGATACTCTTCTTTTGG + Intergenic
981394556 4:144232647-144232669 TGTTTCTGAGTCTCACCTTTGGG - Intergenic
985133679 4:186764412-186764434 TGTTTTTGAATCTTATCTTTAGG + Intergenic
985361545 4:189180751-189180773 CATTGTTGAAGCACATCTTTGGG + Intergenic
991500385 5:67270409-67270431 CGTTTTTAAGGTGCATCTTGGGG + Intergenic
993513946 5:88806145-88806167 GGTTTTTGAGGCACATATTCTGG + Intronic
994063553 5:95509044-95509066 GGTTTTTGTTGCTCATCTTAAGG - Intronic
996032200 5:118717971-118717993 ATTTATTGAGGCTCATTTTTTGG - Intergenic
997116579 5:131131910-131131932 CATTTTTGGGGCTGATCTTGTGG - Intergenic
1002700132 5:181118272-181118294 CGTTTTTTAAACTCATCTGTTGG - Intergenic
1011499753 6:87975226-87975248 TGTCTTTGAGGCTCATCTTCTGG + Intergenic
1012160242 6:95875425-95875447 AATTTTTGAGGATCATCTTGAGG + Intergenic
1012334523 6:98038608-98038630 TGTTTTTGAGAGTCAACTTTAGG + Intergenic
1016846677 6:148574816-148574838 CGTTTTTGAAGCATATCTGTAGG - Intergenic
1018991689 6:168678659-168678681 AGTTTTAGAGGCTCACCTTAAGG - Intergenic
1020749538 7:12123252-12123274 TGTTTCTGAGGCTCTTATTTTGG - Intergenic
1021428581 7:20532960-20532982 CATTTTTGAGGCACAGCGTTTGG - Intergenic
1023977113 7:45038824-45038846 TGTGTTTGAGGCTCATCATTGGG + Intronic
1025307271 7:57872804-57872826 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1025838443 7:65119640-65119662 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1025878834 7:65513456-65513478 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1025884629 7:65576341-65576363 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1028032031 7:85928114-85928136 TTTTTTAGAAGCTCATCTTTTGG - Intergenic
1032564301 7:132925822-132925844 CGTTTTTGAGGCTCATCTTTTGG - Intronic
1032992659 7:137411068-137411090 CTTTTTTTAGGCGCATCTGTTGG - Intronic
1034288408 7:149907088-149907110 TGTTTTTGAGGCTTCTCTCTGGG - Intergenic
1034662724 7:152785892-152785914 TGTTTTTGAGGCTTCTCTCTGGG + Intronic
1037075830 8:14716663-14716685 CATTTTTGCAACTCATCTTTAGG + Intronic
1037412420 8:18612874-18612896 CGACTCTGTGGCTCATCTTTTGG - Intronic
1037873565 8:22523867-22523889 CGTTTTTGGAACTCCTCTTTTGG - Intronic
1042430284 8:68698795-68698817 AGATTTTGAGCCTCATATTTGGG + Intronic
1042644698 8:70973853-70973875 ATTTTTTGAGGCTCATTTTGTGG + Intergenic
1046537138 8:115530009-115530031 CGATATTCAGGCTCAGCTTTTGG - Intronic
1046574183 8:116004849-116004871 CATTTTTGATGCTCATTGTTAGG - Intergenic
1051102080 9:13533182-13533204 TCTTTTTCAGGATCATCTTTTGG + Intergenic
1052015797 9:23464304-23464326 GGTTTCTGAGGCCAATCTTTAGG - Intergenic
1052876217 9:33567760-33567782 TGTTTTTGAGTGTGATCTTTAGG + Intronic
1053697925 9:40655158-40655180 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1053943933 9:43285357-43285379 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1054309216 9:63454566-63454588 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1054408011 9:64778684-64778706 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1054441157 9:65262514-65262536 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1054489119 9:65758975-65758997 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1057542975 9:95993173-95993195 CCTTTCTGAGGATCATCTTGGGG - Intronic
1060426294 9:123509517-123509539 CGTTTTTGAGCCTTCTCTCTGGG + Intronic
1060564001 9:124572892-124572914 GCTTTTTGATGCTCATTTTTTGG - Intronic
1060910279 9:127344177-127344199 AGTTGTTAAGTCTCATCTTTTGG - Intronic
1202780288 9_KI270717v1_random:28352-28374 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1203582234 Un_KI270746v1:19672-19694 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1203587068 Un_KI270747v1:13934-13956 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1203616260 Un_KI270749v1:68756-68778 TGTTTGTGAGGCTTATGTTTGGG - Intergenic
1186406463 X:9308305-9308327 CTTTTTTGACACTGATCTTTAGG + Intergenic
1186538359 X:10373132-10373154 AGTTATTGAGGGTCTTCTTTGGG + Intergenic
1188641745 X:32514181-32514203 CCTGGTTGAGGCTCATCTCTGGG - Intronic
1193599014 X:83485909-83485931 AGTTTTTGAGGTGCATCATTAGG - Intergenic
1195511933 X:105725765-105725787 CTTTTTTGAAGCTCAACTTTGGG - Intronic
1199834838 X:151578929-151578951 CTTTTTTCAGGATCATCTGTTGG + Intronic
1201195055 Y:11485080-11485102 TGTTTGTGAGGCTTATGTTTGGG + Intergenic
1201760739 Y:17535521-17535543 CTATTTTGAGGCTAATTTTTAGG + Intergenic
1201840813 Y:18370469-18370491 CTATTTTGAGGCTAATTTTTAGG - Intergenic