ID: 1032564307

View in Genome Browser
Species Human (GRCh38)
Location 7:132925835-132925857
Sequence CTCAAAAACGAGTTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032564301_1032564307 -10 Left 1032564301 7:132925822-132925844 CCAAAAGATGAGCCTCAAAAACG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1032564307 7:132925835-132925857 CTCAAAAACGAGTTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032564307 Original CRISPR CTCAAAAACGAGTTGGGGAT GGG Intronic
No off target data available for this crispr