ID: 1032565615

View in Genome Browser
Species Human (GRCh38)
Location 7:132939687-132939709
Sequence TTGGAAAGGAAGAATGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032565611_1032565615 -4 Left 1032565611 7:132939668-132939690 CCTTTGAACAAACGAAAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 199
Right 1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032565615 Original CRISPR TTGGAAAGGAAGAATGAAGA GGG Intronic
No off target data available for this crispr