ID: 1032565851

View in Genome Browser
Species Human (GRCh38)
Location 7:132942100-132942122
Sequence ATATAGGCCTAGAATTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032565851_1032565856 29 Left 1032565851 7:132942100-132942122 CCTATACAATTCTAGGCCTATAT 0: 1
1: 0
2: 1
3: 17
4: 100
Right 1032565856 7:132942152-132942174 ACACTTCTAATAAGAAAGAGCGG 0: 1
1: 0
2: 2
3: 25
4: 269
1032565851_1032565855 -1 Left 1032565851 7:132942100-132942122 CCTATACAATTCTAGGCCTATAT 0: 1
1: 0
2: 1
3: 17
4: 100
Right 1032565855 7:132942122-132942144 TTCATTGGCTGGAAACATTCAGG 0: 1
1: 0
2: 1
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032565851 Original CRISPR ATATAGGCCTAGAATTGTAT AGG (reversed) Intronic
910030626 1:82717786-82717808 AAAGAGGCCTGGAATTATATTGG + Intergenic
911934072 1:103944313-103944335 ATATAGGACTGGAAATGAATTGG + Intergenic
911971744 1:104447234-104447256 ATATAGGCTCAGATTTCTATGGG - Intergenic
913303027 1:117393417-117393439 ATATAGGCCAAGAATGATTTTGG - Intronic
916591942 1:166199928-166199950 ATATAGTGCTATAATTGTATTGG + Intergenic
918721965 1:187864083-187864105 ATATAGGCCTAGCCTTGCAAGGG + Intergenic
919267620 1:195291766-195291788 ATATAGGCCTTCAATTCTTTTGG + Intergenic
919427626 1:197452429-197452451 ATATAGGCCTAGGATCTTAGAGG + Intronic
919585508 1:199434151-199434173 ATATATAACTAGAATTGTGTTGG + Intergenic
922084023 1:222328191-222328213 ATATAGAACTAGATTTGTAGAGG - Intergenic
924109668 1:240685651-240685673 ATCTGGGCCTAGAATTTTGTCGG - Intergenic
1066090644 10:32015827-32015849 TTAAAGGCTAAGAATTGTATAGG - Intronic
1070723150 10:78770556-78770578 ATCTAGCACTAGAATTGCATGGG - Intergenic
1071629959 10:87211761-87211783 ATAAAGTGCTAGAATTTTATTGG - Intergenic
1071839647 10:89456325-89456347 ATATATGTCTAGAATCCTATGGG - Intronic
1072043268 10:91629864-91629886 ATACAGACCTAGGATTGCATGGG + Exonic
1078106355 11:8360440-8360462 ATATATGCCATGACTTGTATTGG - Intergenic
1081093025 11:38896491-38896513 ATATATGTCCAGAATTATATTGG - Intergenic
1085999595 11:81965775-81965797 ATCTAGGAGGAGAATTGTATAGG - Intergenic
1086141060 11:83500928-83500950 TCATAAGCCTAAAATTGTATAGG + Intronic
1086555459 11:88105376-88105398 ATATAGCCATAGATTTGTATAGG - Intergenic
1086770892 11:90765152-90765174 ATCTATGTCTAGAATTGTTTTGG + Intergenic
1091548584 12:1520652-1520674 GTATAGGCTTAGAAAGGTATTGG - Intergenic
1092725518 12:11481893-11481915 ATATAGGCTACTAATTGTATAGG - Intronic
1093825476 12:23680632-23680654 ATATAGGCCCATAAATGTAATGG + Intronic
1095784273 12:46092653-46092675 CTTTAGGACTAGAATAGTATTGG - Intergenic
1097562601 12:61226417-61226439 ATATAGACCCATAATTGTTTGGG - Intergenic
1098411866 12:70194732-70194754 ATATAGGTCTAATATTGTGTTGG + Intergenic
1101151323 12:101885227-101885249 ATATAATCATAAAATTGTATTGG - Intronic
1107298500 13:38940610-38940632 AGATAGTACTAGAATTGAATTGG - Intergenic
1108557490 13:51609078-51609100 ATATAGGCAAAGAGTTGAATAGG - Intronic
1110770280 13:79335092-79335114 ATAAAGGACTAGAATTTTGTGGG - Intronic
1114980742 14:28160240-28160262 ATCTAGGCCTGTCATTGTATCGG - Intergenic
1116122200 14:40735209-40735231 ATATAGGACTATAATTAGATGGG + Intergenic
1118418476 14:65572039-65572061 ATCTAGGCCTACCAGTGTATAGG + Intronic
1118739354 14:68727884-68727906 ACAGATGCCTAGACTTGTATGGG - Intronic
1119983781 14:79112783-79112805 ATATAGGCCAAGATATGTAGTGG + Intronic
1122187571 14:100012949-100012971 ATAGTGGCCCAGAATTGTAATGG + Intronic
1126461963 15:48924032-48924054 TTCTAGGCCTAGAATTTCATGGG + Intronic
1133999827 16:10774243-10774265 AAAAAGGCCTTGAATTGTAGTGG + Intronic
1137780920 16:51097280-51097302 TTATAGACAGAGAATTGTATAGG + Intergenic
1143228858 17:5333700-5333722 ATCTAGGCCTGGTTTTGTATTGG + Intronic
1153100311 18:1460880-1460902 ATATAGGGCTAGAACGATATTGG - Intergenic
1154459795 18:14570573-14570595 AGATAGGTGTATAATTGTATGGG + Intergenic
1157835218 18:50895359-50895381 ATCTAGACCTAGAATTTTAATGG - Intronic
1159303113 18:66603401-66603423 ATATATGCCTAAAATTGTACAGG - Intronic
925526192 2:4805024-4805046 ATGTAGGCCTAGGATTATAAAGG - Intergenic
932585744 2:73027235-73027257 ATGTAGGCCTAGAATGATATGGG + Intronic
933406203 2:81862909-81862931 ATATAGACCTTGAGTTATATAGG - Intergenic
939260657 2:139804378-139804400 AAATATGCCTAGAATTGGATAGG - Intergenic
939453659 2:142404526-142404548 ATATTGGCCTAAAATTTTCTTGG + Intergenic
939601415 2:144196261-144196283 ATATATGCTTTGAATTATATTGG + Intronic
940517933 2:154704655-154704677 ATGTAGACCTAGAATTTTATTGG - Intronic
945772743 2:214065278-214065300 AAATAGGCCTAAAATTGCAAAGG + Intronic
946625547 2:221608751-221608773 ATATAGGCATACATTTGTTTAGG + Intergenic
1170292787 20:14789160-14789182 ATATAGGCCTAAATTTTTAATGG - Intronic
1171912044 20:30971906-30971928 CTTTAGGCCTAGGATTGTCTTGG + Intergenic
1176814323 21:13582253-13582275 AGATAGGTGTATAATTGTATGGG - Intergenic
1177534993 21:22413985-22414007 ATATAGGCATACAATGATATAGG + Intergenic
1177957880 21:27623461-27623483 ATACTGGCCTAAAATTATATTGG + Intergenic
1177961588 21:27673508-27673530 ATATAGGCCTAGAAGGGTCTAGG + Intergenic
1179315385 21:40239623-40239645 ATAAGTGCCTAGAATTTTATAGG + Intronic
952021864 3:29032390-29032412 ATATAAGCCTAGCATTTTCTTGG - Intergenic
958092845 3:88898960-88898982 AAATAGGCCATGAATTGCATAGG - Intergenic
959434940 3:106303150-106303172 ATATAGGCCCAGAATTTTAACGG - Intergenic
962475201 3:135749238-135749260 ATAAAGGCCTATATTTGGATGGG - Intergenic
962954892 3:140255807-140255829 ATTTAGGCATAGAAATGTCTAGG + Intronic
964363480 3:155923791-155923813 ATATAGCCCTAGAATTTAATTGG + Intronic
965188293 3:165494565-165494587 ATTTAGTTCTAGAATTTTATGGG + Intergenic
971570804 4:28208340-28208362 ATCTAAGAGTAGAATTGTATAGG - Intergenic
973129390 4:46631595-46631617 ACATATGTCTAGAATGGTATTGG + Intergenic
975195674 4:71520653-71520675 CTATAAGCCTAGAAGAGTATAGG - Intronic
978934819 4:114361473-114361495 ATAGAAGCCTAGTGTTGTATTGG + Intergenic
979727451 4:123980428-123980450 ATGTAGGCCTAGAATTTTCTTGG - Intergenic
980247223 4:130262918-130262940 ATTTAGGCACAGAATTGTTTAGG - Intergenic
980643204 4:135605885-135605907 ATATAGGCATATAATTATATAGG - Intergenic
980643205 4:135605901-135605923 ATATAGGCATATAATTATATAGG - Intergenic
980643206 4:135605917-135605939 ATATAGGCATATAATTATATAGG - Intergenic
981258465 4:142691364-142691386 ACATAGGCCTAGGATTGTGTGGG - Intronic
981917283 4:150048769-150048791 ATATGTGCTTAGCATTGTATGGG - Intergenic
982779145 4:159472113-159472135 ATAAAGGCCTACCCTTGTATAGG - Intergenic
984543710 4:181073488-181073510 AAATAGGTGTAGAAGTGTATTGG - Intergenic
986867150 5:12003168-12003190 ATATATGCCTAAAAATATATTGG + Intergenic
988090523 5:26534082-26534104 ATGTTGGCCTTAAATTGTATGGG + Intergenic
992086636 5:73283726-73283748 ATCTAGGCCTAGAACAGTGTTGG + Intergenic
993284098 5:85967400-85967422 ATATATACATTGAATTGTATAGG - Intergenic
993652590 5:90540024-90540046 AAATGGGCCTAGAATTGAACAGG + Intronic
996839503 5:127831493-127831515 ATATAGGCATTGAATTTTGTTGG - Intergenic
997101831 5:130978209-130978231 ATATGGGCCTAGATTTGTGATGG + Intergenic
997917424 5:137942038-137942060 ATTCAGGCCTAGAATTGAAATGG + Exonic
998210894 5:140197104-140197126 ATATTGGCCTAGAAATGGACAGG - Intronic
998677881 5:144429973-144429995 AGATAGGCCTAGCTTTTTATAGG + Intronic
999593028 5:153170054-153170076 ATATAGTCCTATATTAGTATGGG + Intergenic
1004365281 6:15007729-15007751 ATTAAGGCCTATAATTGCATGGG + Intergenic
1008160042 6:48066006-48066028 TTATAGGCCTAGCATGGTGTTGG + Intronic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1011995208 6:93578042-93578064 AGACAGGGCTAGAATTGTAAAGG + Intergenic
1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG + Intronic
1016528407 6:145030487-145030509 ATATAGGTCTTGATTTGTAGAGG + Intergenic
1020463076 7:8444987-8445009 ATACAGTCCTAGTATTGTGTTGG - Intronic
1020878823 7:13732953-13732975 ATATAAGCCTACAATTGTGTTGG - Intergenic
1021395277 7:20139768-20139790 ATATAGGACAAAAATTGTATAGG - Exonic
1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG + Intergenic
1023773333 7:43580283-43580305 CTAAAGTCCTAGGATTGTATAGG - Intergenic
1025867977 7:65404152-65404174 ATAAAGGACTAGAATTGTATGGG + Intergenic
1026514355 7:71055283-71055305 ATATATGCAAAGAATTTTATGGG - Intergenic
1027717993 7:81698204-81698226 ATATAGGTTTAGAATGGAATGGG + Intergenic
1032565851 7:132942100-132942122 ATATAGGCCTAGAATTGTATAGG - Intronic
1032974080 7:137201543-137201565 ATATATGCATAGATTTGTAGGGG - Intergenic
1034471995 7:151259935-151259957 ACATCGGCTTAGATTTGTATAGG + Intronic
1037160063 8:15758904-15758926 ATAAAGGCCTAGATTTCTTTAGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1052630892 9:31037105-31037127 ATATAGGCCAGGAATAGAATGGG - Intergenic
1053941403 9:43252809-43252831 TTATTGTCCTAGAATTGTTTTGG - Intergenic
1054850621 9:69843270-69843292 ATACAGGGCTAGAATTGTTTAGG - Intronic
1056301980 9:85251151-85251173 TTATAGGGCCAGAATTTTATAGG - Intergenic
1058477768 9:105356946-105356968 ATATAGTTCTAGAATAATATAGG - Intronic
1189649980 X:43178308-43178330 ATGTAGGCCTAGGATTACATAGG + Intergenic
1189941773 X:46131115-46131137 ATAGAGGCTTAGAAATATATTGG - Intergenic