ID: 1032566792

View in Genome Browser
Species Human (GRCh38)
Location 7:132954832-132954854
Sequence GACCACAATGAGCCTCCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032566792 Original CRISPR GACCACAATGAGCCTCCGTC AGG (reversed) Intronic
903156905 1:21451624-21451646 GACCAGCATGAGCTTCTGTCAGG + Intronic
913992708 1:143629452-143629474 GACCAGCATGAGCTTCTGTCAGG - Intergenic
914929071 1:151913827-151913849 CACCAAAATGAGTCTCCGGCTGG + Intergenic
916301375 1:163278197-163278219 GACCATAATGTGCCTCAGACAGG - Intronic
922289903 1:224201415-224201437 ATCCACAAAGAACCTCCGTCTGG + Intergenic
923511850 1:234659830-234659852 GCCCACAATGGGCCGCCGGCAGG + Intergenic
1066466340 10:35653656-35653678 GACCACAATGGGCTTAAGTCAGG + Intergenic
1075860142 10:125668005-125668027 GACAACCAAGGGCCTCCGTCTGG - Intronic
1076544657 10:131237131-131237153 GCCCACAGAAAGCCTCCGTCAGG - Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077618496 11:3697121-3697143 CACCACATCCAGCCTCCGTCTGG - Intronic
1088433845 11:109788934-109788956 GAGGACAATGAGGCTCTGTCAGG - Intergenic
1102369353 12:112369128-112369150 GACCAAAATGAGCCTATGCCGGG + Intronic
1108599282 13:51977023-51977045 GATTACAATGAGCCACTGTCTGG - Intronic
1122019173 14:98821998-98822020 GCTCCCAATGAGACTCCGTCAGG - Intergenic
1122257694 14:100491107-100491129 GACCACAGTGTGCCTCCTGCAGG + Intronic
1128745197 15:70109362-70109384 GACCCCAAAAAGCCTCAGTCAGG - Intergenic
1129605339 15:77022235-77022257 GCCCACGATGAGCCAGCGTCAGG - Intronic
1136408687 16:30064451-30064473 GACAACCAAGGGCCTCCGTCTGG + Exonic
1137562223 16:49510275-49510297 GACGACAATGAGTCACCGTGAGG + Intronic
1142219643 16:88847616-88847638 GACCAAAGTGAGCCTCTCTCCGG - Intronic
1147191180 17:38739056-38739078 GAGCACACTCACCCTCCGTCAGG + Exonic
1148031987 17:44628018-44628040 GAGGACAATCAGCCTCCGTTTGG - Intergenic
1151518963 17:74614961-74614983 GATCACACTGAGCCTGTGTCGGG - Intronic
1160503297 18:79412934-79412956 GATCACAACGAGCCTGTGTCAGG + Intronic
1162638634 19:11989491-11989513 GACAACAATGATCCTCCGAGGGG + Intergenic
1162797176 19:13092862-13092884 GGCCCCAATGAGCCTCTGTTTGG + Intronic
1163992036 19:21007766-21007788 GACAACAATGATCCTCCGAGGGG - Intergenic
925634905 2:5933689-5933711 GCCCACCATGAGCCTAAGTCTGG - Intergenic
929682489 2:44005571-44005593 GATCACAATGAGCCACATTCAGG + Intergenic
930751768 2:54941451-54941473 GACAACAAAGGGCCTCTGTCCGG - Intronic
945976290 2:216273773-216273795 GACCACGCTGAGCCTCCTTCTGG + Intronic
947014151 2:225599499-225599521 GAGCACACTGGGCCTCCATCAGG + Intronic
948850125 2:240701712-240701734 GACCACAGTGCGCCGCCGCCTGG - Intergenic
1173410940 20:42808919-42808941 GAGAACAGTGAGCCTCCCTCCGG - Intronic
1173858377 20:46266078-46266100 GTCCACAGAGAGCCTCCCTCTGG - Intronic
1176071832 20:63230990-63231012 GAGCACACTGAGACTCCGGCAGG - Intergenic
1177307774 21:19342540-19342562 CACCACACCCAGCCTCCGTCTGG + Intergenic
1177890222 21:26795770-26795792 CACCACAATGGGCCTCTGTCGGG + Intergenic
1185003731 22:48263052-48263074 TTCCACAAAGAGCCTCCATCAGG + Intergenic
951583887 3:24195660-24195682 GGCCCCACTGAGCCTCCCTCTGG + Intronic
951773953 3:26287884-26287906 CACCACAACTAGCCTCAGTCAGG - Intergenic
953537561 3:43787702-43787724 GTCCACAATGAACCTCTCTCTGG - Intergenic
976381242 4:84401726-84401748 GACTACAATGAGCCTAAGACTGG + Intergenic
986483111 5:8209427-8209449 GACCACTGTGAGCCTCCATGGGG + Intergenic
990404426 5:55474014-55474036 TGACACAATGAGACTCCGTCTGG - Intronic
1005179322 6:23086120-23086142 CACCACCATGAGCCTGTGTCAGG + Intergenic
1006140400 6:31925685-31925707 GACTACATTGAGCTTCCATCAGG + Intronic
1019344841 7:524430-524452 GAGCAAAATGAGCCTCCGGGAGG - Intergenic
1032566792 7:132954832-132954854 GACCACAATGAGCCTCCGTCAGG - Intronic
1044657826 8:94566681-94566703 AACCACAATGAGCCTGGGTGAGG + Intergenic
1045621255 8:103980782-103980804 GACCACAAGGGGGTTCCGTCAGG - Intronic
1045651177 8:104342807-104342829 GACCAGGATGGGCCTGCGTCCGG + Intronic
1049112830 8:140659454-140659476 GACCACACTGAGCCTCCCCTAGG - Exonic
1049881267 8:145065641-145065663 GACAACAATGATCCTCCGAGGGG - Intergenic
1051348289 9:16172262-16172284 AGCCACAATGAGCCCCCGTGAGG - Intergenic
1051740832 9:20250360-20250382 GATGACAATGAGCCCCCATCTGG + Intergenic
1060976972 9:127770607-127770629 GACCAGATTGAGCCCCCTTCTGG - Intronic
1187343493 X:18442173-18442195 CATCACAATGAGCCTACCTCAGG + Exonic
1197747133 X:129939211-129939233 GGCAAGAATGAGACTCCGTCAGG + Intergenic
1199792492 X:151168363-151168385 GCCCACAATGAGCCCCCATTTGG - Intergenic