ID: 1032574618

View in Genome Browser
Species Human (GRCh38)
Location 7:133040132-133040154
Sequence TCTAAGTCTGCATGTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032574618_1032574620 6 Left 1032574618 7:133040132-133040154 CCTCAAAAACATGCAGACTTAGA 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1032574620 7:133040161-133040183 AGCTAAAAATCAGCTATGTTGGG 0: 1
1: 0
2: 5
3: 43
4: 350
1032574618_1032574621 24 Left 1032574618 7:133040132-133040154 CCTCAAAAACATGCAGACTTAGA 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1032574621 7:133040179-133040201 TTGGGTATACTTGCAAGAGCTGG No data
1032574618_1032574619 5 Left 1032574618 7:133040132-133040154 CCTCAAAAACATGCAGACTTAGA 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1032574619 7:133040160-133040182 AAGCTAAAAATCAGCTATGTTGG 0: 1
1: 0
2: 0
3: 18
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032574618 Original CRISPR TCTAAGTCTGCATGTTTTTG AGG (reversed) Intronic
900833600 1:4983237-4983259 TGGATGTCTGCATCTTTTTGTGG - Intergenic
902253031 1:15168279-15168301 TCTATCTCTGCATTTTTCTGTGG + Intronic
903201847 1:21747265-21747287 TCTAATTGTACATGTTTTGGAGG - Intronic
904014497 1:27409500-27409522 TCTAAATCTCCATATTTTTAGGG + Intronic
905591179 1:39165279-39165301 TGGAAGTCTGCATGCTTCTGGGG + Intronic
907954073 1:59211920-59211942 TTTTAGTTAGCATGTTTTTGAGG - Intergenic
909512722 1:76473083-76473105 GCTAAGAATGCATGTCTTTGTGG + Intronic
909922375 1:81398487-81398509 TATACTTTTGCATGTTTTTGTGG + Intronic
910476748 1:87615696-87615718 TCTAAGACTGAATGTTATTTGGG - Intergenic
911063371 1:93766337-93766359 ACTAAGTGTGCATGTGTTTGGGG + Intronic
911886719 1:103310626-103310648 TCAAAGTTTGCAGGTTTTGGGGG - Intergenic
911968677 1:104401468-104401490 ACTAAGTCTGCAAGTTCATGTGG + Intergenic
913199199 1:116482509-116482531 TCTATGTCTGCTTGCTTTTTGGG - Intergenic
914764471 1:150625854-150625876 TGTGAGTCTCCTTGTTTTTGAGG - Intronic
914785748 1:150828729-150828751 GCTAAATCTGCATGTTTTATGGG + Intronic
915850656 1:159318515-159318537 TATAATTCTGCATATTTGTGTGG - Intergenic
916930935 1:169577333-169577355 TTTGAGTCTGCATATTTTTCAGG - Intronic
917185862 1:172354562-172354584 TCAAACTCTACATGTCTTTGTGG - Intronic
917502856 1:175601365-175601387 TATATGTTTGCATGTCTTTGGGG + Intronic
918180784 1:182084830-182084852 TGCAAGTCAGCATGTGTTTGTGG - Intergenic
919113816 1:193255563-193255585 TCTTCGTATGAATGTTTTTGGGG - Intergenic
920202995 1:204271764-204271786 CCTAAATCTGCAGGTTTGTGTGG - Intronic
922117321 1:222626827-222626849 TCTCAGTCTACATGGATTTGGGG - Intronic
922778702 1:228232486-228232508 AATAAGTCTGCCTGTCTTTGGGG + Intronic
924187265 1:241506584-241506606 TCTATGTTTGCATTTTTTTGGGG - Intronic
1063541910 10:6942573-6942595 TCTAAGTAGGCATGTTTTCGAGG + Intergenic
1064960518 10:20958895-20958917 ACTCAGTCTGCATGTTACTGAGG - Intronic
1068036505 10:51766364-51766386 TCTTACTGTGCATGTTTTAGGGG + Intronic
1068343189 10:55735875-55735897 TTTAAATCTGTATGTGTTTGGGG - Intergenic
1068428548 10:56900897-56900919 TCTAAGTCTGTATTTTTTTAAGG + Intergenic
1068665048 10:59664857-59664879 TGTAAGTCTTCATCTTTTAGAGG + Intronic
1069302257 10:66922837-66922859 AGTAAGTGTGCATGTTTATGGGG + Intronic
1070873969 10:79783979-79784001 TAGAAGTCTGTCTGTTTTTGAGG - Intergenic
1071640901 10:87306118-87306140 TAGAAGTCTGTCTGTTTTTGAGG - Intergenic
1071654335 10:87431818-87431840 TAGAAGTCTGTCTGTTTTTGAGG + Intergenic
1071694587 10:87858377-87858399 TCTAAGTCTGCCTTTTTTCATGG + Intergenic
1072218840 10:93310484-93310506 TCTCAGCCTGCAGGTGTTTGGGG + Intronic
1073171539 10:101513557-101513579 TTTGATTCAGCATGTTTTTGAGG + Intronic
1073183367 10:101600312-101600334 TTTTCCTCTGCATGTTTTTGAGG + Intronic
1073332820 10:102681824-102681846 TCTGAGTGTGCATGTGTGTGTGG - Intronic
1073379807 10:103069483-103069505 TCTTAATTTGCATGTTTCTGAGG + Intronic
1073720822 10:106169374-106169396 TTTAAACCTGCTTGTTTTTGCGG - Intergenic
1079552494 11:21716971-21716993 TCTGAGTCTGTATGTTGTTTTGG + Intergenic
1079586569 11:22132373-22132395 TCTCAGCCTGGATGTTATTGAGG - Intergenic
1079698796 11:23518468-23518490 TCTGTGTCTGCATGTTGTTTTGG - Intergenic
1080876346 11:36278493-36278515 TCTTTGTCAGCAGGTTTTTGAGG + Exonic
1081228267 11:40552389-40552411 TTGAAGTCTGCATGATGTTGAGG - Intronic
1082991326 11:59209716-59209738 TCAATGTCTGCATGGTTCTGGGG - Exonic
1083558045 11:63648129-63648151 TCTAAGTCTAGATTTTTTTTTGG - Intronic
1086182477 11:83969987-83970009 TCTCAGTATAGATGTTTTTGTGG - Intronic
1089127657 11:116188446-116188468 TTTGAGTGTGCATGTTTATGAGG + Intergenic
1089359213 11:117875274-117875296 TATATGTCTGTATGTGTTTGTGG + Intronic
1089422973 11:118345573-118345595 TCTAAGAATAAATGTTTTTGAGG + Intronic
1090135377 11:124192539-124192561 TCTAAGTCTGCTTTGTTATGGGG + Intergenic
1090429995 11:126637681-126637703 TCTAAGTCTGGATATCTCTGCGG + Intronic
1091073532 11:132592218-132592240 TCAAAGTGTGCATGTTTTGCGGG + Intronic
1091083590 11:132696796-132696818 TCTAATTCTGCAGGTTTTATGGG - Intronic
1092822155 12:12362960-12362982 TCTTAGTTTTCATGATTTTGAGG + Intronic
1093102356 12:15042349-15042371 TCTAAGACTTCATGTTTATTTGG + Intergenic
1093225520 12:16479076-16479098 TCTCACTTAGCATGTTTTTGAGG + Intronic
1094259893 12:28481911-28481933 ACTAACTCTTCATGTTTTTTTGG + Intronic
1095165102 12:38962948-38962970 TGTAAGTATGCGTGTCTTTGCGG - Intergenic
1095327458 12:40913151-40913173 TGTATTTCTGCAAGTTTTTGAGG + Intronic
1095522436 12:43083845-43083867 TCTGTGTGTACATGTTTTTGTGG - Intergenic
1097578451 12:61423954-61423976 TACCAGTCTGCATGTTTCTGTGG + Intergenic
1098400491 12:70070032-70070054 TCTATGTATGCATGTTGGTGAGG - Intergenic
1098650164 12:72955505-72955527 TCCAAGTCAACATGTTTTTCTGG + Intergenic
1098668271 12:73192798-73192820 TATAAGTCAGCATGTTTGTCAGG - Intergenic
1098798987 12:74929278-74929300 TGTATGTTTGCTTGTTTTTGAGG + Intergenic
1098856531 12:75658935-75658957 TCTAGCTCTGCATGCTTTTGTGG - Intergenic
1103487827 12:121295407-121295429 TCTGAAACTGCATGTTTTTGTGG + Intronic
1103823916 12:123720687-123720709 TTTAAGTCTGCATTCTTATGGGG - Intronic
1105827442 13:24134947-24134969 TCTAAGTCTCCACTTTTTTAAGG - Intronic
1106669069 13:31885797-31885819 TCTAAGCCTGTAACTTTTTGGGG + Intergenic
1109658772 13:65430531-65430553 TTTTACTCTGCAAGTTTTTGTGG + Intergenic
1109660541 13:65453260-65453282 TCACAGTCTGTAAGTTTTTGTGG + Intergenic
1111439049 13:88254179-88254201 TTTATGTATGAATGTTTTTGTGG + Intergenic
1111764715 13:92513674-92513696 TCTCAGACTTCAGGTTTTTGGGG + Intronic
1112149532 13:96742439-96742461 TCTGTGTCTGTATGTTTTAGGGG - Intronic
1116879929 14:50156006-50156028 TCTAAAACTGCATTTGTTTGTGG + Intronic
1117900444 14:60527357-60527379 TACAATTCAGCATGTTTTTGCGG + Intergenic
1118013728 14:61637090-61637112 CCTAAGGCTCCATGTTTTAGAGG + Intronic
1118014814 14:61649278-61649300 TCTAATACTGCATTATTTTGTGG - Intronic
1118206162 14:63725398-63725420 TCTAAATTTGCATGATTTTTCGG - Intronic
1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG + Intergenic
1118734914 14:68694378-68694400 CCTGAGTCTTCATGTTTATGAGG + Intronic
1118924957 14:70183764-70183786 TATAAGTCTGCCTGTTTTCATGG + Intronic
1121294033 14:92802375-92802397 TCTTAATCTTCATGTTTTTCTGG + Intronic
1124233122 15:27964122-27964144 TATAGGCCTGGATGTTTTTGTGG - Intronic
1127865769 15:63031490-63031512 TCTGTGTCTGTATGTTTTTGGGG - Intergenic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1130625760 15:85512856-85512878 TGTATGTATGTATGTTTTTGAGG + Intronic
1130875364 15:88009083-88009105 TCATTGTCTGCATGTTTTTGAGG + Intronic
1131625745 15:94118774-94118796 TCTAAGTTTTCATGGTTTTGGGG - Intergenic
1132020110 15:98353627-98353649 TCTATGTCTGAAAGTTCTTGAGG + Intergenic
1135007319 16:18837817-18837839 TGTAACTGTGCATGTTTGTGTGG + Intronic
1140525054 16:75615809-75615831 TCTCAATCTGCATGTTCTTCAGG + Intronic
1140586210 16:76295255-76295277 TCAAAGACTCCATGCTTTTGTGG - Intronic
1140726008 16:77813065-77813087 TCTTAGTTAGAATGTTTTTGGGG - Intronic
1141000263 16:80301195-80301217 TTTCACTCAGCATGTTTTTGAGG + Intergenic
1141036251 16:80628876-80628898 TGTTAGTCTACATGTATTTGTGG - Intronic
1141713265 16:85712562-85712584 TCTAGGTGTACATGCTTTTGTGG - Intronic
1145982834 17:29024145-29024167 TCCATGTCTGCATGCTCTTGAGG - Intronic
1147357170 17:39907173-39907195 CCTATGACTGCCTGTTTTTGAGG - Intronic
1148771220 17:50068024-50068046 ACTAAGGCTGCCTGTGTTTGGGG + Intronic
1149170579 17:53805751-53805773 TCTAAATATACCTGTTTTTGAGG - Intergenic
1150953353 17:69826699-69826721 TCTATGTGTGCATGTTGTGGGGG + Intergenic
1153853949 18:9126343-9126365 CCTAATTCAGCACGTTTTTGAGG - Intronic
1155601524 18:27554114-27554136 TCTCAGACTGCTTGTTTTAGAGG - Intergenic
1155730892 18:29156875-29156897 TCTTAGTCTGCATCTTCTTGGGG - Intergenic
1156040604 18:32816408-32816430 TGAAAGTCTGCATGTTTTATAGG - Intergenic
1156839078 18:41590069-41590091 TCTACATCTGTTTGTTTTTGCGG + Intergenic
1159938381 18:74386710-74386732 TCTCAGTCTGCCTTTCTTTGTGG + Intergenic
1161043617 19:2123000-2123022 TCAGCCTCTGCATGTTTTTGCGG - Intronic
1161544052 19:4869027-4869049 TCTGTGACTGCATTTTTTTGGGG + Intergenic
1164059569 19:21658647-21658669 TAAACGTCTGCATGTGTTTGTGG - Intergenic
1164309794 19:24035460-24035482 GCCAAGTCAGCCTGTTTTTGAGG + Intronic
1166383361 19:42367131-42367153 TCTCATTGTGCACGTTTTTGGGG + Intronic
1167834183 19:52052990-52053012 TATAATTTGGCATGTTTTTGTGG - Intronic
925691634 2:6530190-6530212 TCTGAGTCTTCATGATGTTGAGG - Intergenic
927835550 2:26395456-26395478 TCTAGGTCTGCATGATGATGGGG + Exonic
931110826 2:59109600-59109622 TCTCACACTGCCTGTTTTTGAGG + Intergenic
933194081 2:79369320-79369342 GCTCAGTGTGCATGTTCTTGAGG - Intronic
933571831 2:84022984-84023006 TCTAAATCTGTATGTTTTGCTGG - Intergenic
937009930 2:118553290-118553312 TCAAAGTCTCCTTGTTTTTAAGG + Intergenic
937296800 2:120814344-120814366 TCTGTGTCTGTATGATTTTGTGG + Intronic
937846878 2:126588341-126588363 TCTGAGTGTTCATGCTTTTGCGG + Intergenic
937952500 2:127399228-127399250 CCTCAGTCTGCAGGTTTTTAAGG - Intergenic
938873304 2:135505603-135505625 TATAAGTCTGCATGTAATTGAGG - Intronic
940863810 2:158797002-158797024 TTTAAGTCTGAATCTGTTTGTGG + Intronic
940937466 2:159513667-159513689 TTAAATTCTGGATGTTTTTGAGG - Intronic
942540507 2:177010236-177010258 TCTAAGTCTGCCTTTCTTTGTGG + Intergenic
943343821 2:186713265-186713287 TCTAGGGCTGCATGGTTTGGTGG + Intronic
943750944 2:191508863-191508885 CCTAAGGCTTCATGTGTTTGGGG + Intergenic
944172745 2:196797935-196797957 GCTAAGTCTGCATTATTTTTTGG - Intronic
945988475 2:216372795-216372817 TCTCAGTCTGCAAGCTTTCGAGG + Intergenic
946979677 2:225195818-225195840 TCTAAATCTACATGCTTATGGGG - Intergenic
948331722 2:237172704-237172726 TCTACTTTTTCATGTTTTTGTGG + Intergenic
1169539779 20:6586804-6586826 TATAAATCTGCATGTATTTTGGG - Intergenic
1170468552 20:16645275-16645297 CCTCAGTCTTCATGATTTTGTGG + Intergenic
1170663922 20:18369105-18369127 TCTTAATCTGCTTGTCTTTGTGG + Intergenic
1170689100 20:18596018-18596040 TCTAAACCTGCGTGTATTTGAGG + Exonic
1173202461 20:40964036-40964058 TCTAAGTCTACATAGTTTTTTGG + Intergenic
1177476240 21:21627456-21627478 TCTAAGTCTACATGTTTTTTAGG + Intergenic
1177530380 21:22351441-22351463 TCTAAGTCTTCATTTCTTTTTGG + Intergenic
1179185297 21:39081221-39081243 TCTATGTCTTCCTTTTTTTGAGG + Intergenic
1179270548 21:39847447-39847469 TCTAAGGCTGCATGGTTAGGAGG + Intergenic
1179318085 21:40263444-40263466 TCTACCTCTGAATGATTTTGGGG + Intronic
1182996262 22:34815682-34815704 ACTAAGTCTGCATCTCTTTGTGG - Intergenic
949698056 3:6721816-6721838 TCTAAGTCTTCTTGTTTGTTCGG - Intergenic
952775449 3:37041573-37041595 TCTATGTCTGCATTTTGGTGGGG - Intronic
953514305 3:43574808-43574830 TCTAATTCTGAAAGTTTTAGTGG - Exonic
954240586 3:49290448-49290470 TCTAGGACTGCATGTCTTGGAGG + Intronic
954863377 3:53708786-53708808 TCTAAGTCTGCCTCTCTTTAAGG - Intronic
955429805 3:58831069-58831091 TCTTAGTCTTCCTGTTTTTCAGG - Intronic
956548061 3:70428414-70428436 TCTAAATGTGCATGTATTTGTGG - Intergenic
957515015 3:81238931-81238953 TCTAAATCAGGATGTTTTTCCGG + Intergenic
957849962 3:85794978-85795000 AATAATTTTGCATGTTTTTGGGG + Intronic
958557143 3:95694384-95694406 TCTAATTCTGATTGTTTTAGAGG - Intergenic
959261403 3:104086028-104086050 TCTATCTCTGAATGTTTCTGAGG - Intergenic
960226122 3:115171040-115171062 TTTCACTCAGCATGTTTTTGAGG + Intergenic
960829629 3:121832736-121832758 TCCAAATCTTCATGTTTTTTTGG + Intronic
963275722 3:143327924-143327946 TCTAAGTCTGCAACTTCTAGTGG - Intronic
964246534 3:154660202-154660224 TCTATGTCTGCATGTGTGTTTGG - Intergenic
965394093 3:168141330-168141352 TATAAGTCTACTTGTTTTAGTGG - Intergenic
965436009 3:168652352-168652374 TCTAATTCTGCATGCATTTTTGG + Intergenic
967325507 3:188234730-188234752 TCAAACTCTGTATGTCTTTGAGG + Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
970034031 4:11711469-11711491 TCTAAGTCTGCTTCCTCTTGAGG - Intergenic
970215911 4:13760404-13760426 TCTATTTCTGTATGTTTTTATGG + Intergenic
972767516 4:42165587-42165609 TCTAAGTCTTCCTGTTTCTCAGG - Intergenic
973121653 4:46527986-46528008 TGTAAGGCTGCATGTCTTTTTGG - Intergenic
974064544 4:57065585-57065607 ACTCAGACTGCACGTTTTTGCGG - Intronic
975403883 4:73967934-73967956 TATCAGTCTGAAGGTTTTTGTGG - Intergenic
975469395 4:74747807-74747829 TCTAATTCTGCATGGTTGTGGGG - Intronic
977268182 4:94881297-94881319 TCTAAATACGCATGTGTTTGTGG - Intronic
978468862 4:109039263-109039285 TCTAAGACTGCATACTTTTAGGG + Intronic
978975037 4:114858944-114858966 TCTAATTCTTCATGTTTATGTGG - Intronic
979696649 4:123620392-123620414 TCTCATTCTTCATGTTTTGGTGG - Intergenic
980263758 4:130488911-130488933 TCTATTTTTGCCTGTTTTTGGGG + Intergenic
982071943 4:151703185-151703207 TCAAAATTTGCATGTTTATGTGG - Intronic
982922796 4:161297030-161297052 TCTATGTGTGGATGTTTGTGTGG - Intergenic
982933230 4:161436036-161436058 TATTACTCTGCAAGTTTTTGTGG + Intronic
983048413 4:163014233-163014255 TGTTAGGCTGTATGTTTTTGTGG + Intergenic
984449928 4:179886675-179886697 TCTCAGACTGAATGTTATTGGGG - Intergenic
984670937 4:182486636-182486658 TCTAGCTCTGCATTTTTCTGTGG - Intronic
985099197 4:186441434-186441456 TCTTACTGTGCACGTTTTTGAGG - Intronic
987838202 5:23188165-23188187 TATAATTTGGCATGTTTTTGTGG - Intergenic
988107192 5:26767282-26767304 TCTCAATCTGGATGCTTTTGGGG + Intergenic
990417713 5:55601895-55601917 TCTCTGTCTGCATGTCTCTGTGG - Intergenic
991640649 5:68748439-68748461 TCTAAGTCTGTGTGTTTGTGTGG - Intergenic
991660727 5:68948323-68948345 TCTACATCTGCATGTCTTTGTGG - Intergenic
993389339 5:87299101-87299123 TCTAAGGTTGCAATTTTTTGAGG - Intronic
994359275 5:98831771-98831793 TCAAAGTCTGGTTGTTTTAGGGG - Intergenic
995409339 5:111836925-111836947 TCTAAGTCTGTATCATCTTGGGG + Intronic
995977373 5:118056089-118056111 ACTTACTCTACATGTTTTTGTGG + Intergenic
996879445 5:128278255-128278277 TCTAAGCATGAATGATTTTGGGG + Intronic
997141346 5:131384448-131384470 TGTAACTCTGCTTGGTTTTGAGG + Intronic
998518265 5:142776038-142776060 TTCAGGTCAGCATGTTTTTGGGG + Intronic
998746815 5:145270439-145270461 TTTCACTCAGCATGTTTTTGAGG - Intergenic
998977101 5:147660571-147660593 CTAAAGTCAGCATGTTTTTGTGG - Intronic
999890457 5:155973592-155973614 CCTAAGTCTGCAAGTTAGTGGGG + Intronic
1001168570 5:169394273-169394295 TCTTAATCTGCATGTTGTTGGGG - Intergenic
1002480673 5:179498714-179498736 TCTACGTCTCCATGATTGTGTGG + Intergenic
1002621399 5:180491152-180491174 TCTAAGCCTGCAGGTGTTGGTGG + Intergenic
1004161725 6:13220038-13220060 CTTAACTCTGCAAGTTTTTGTGG + Intronic
1004477558 6:15988079-15988101 TCCAACTCTGCAAGTGTTTGGGG - Intergenic
1006843942 6:37050026-37050048 CCTAAGTGTGCATGTTGGTGGGG + Intergenic
1008705064 6:54147766-54147788 TGTAAGTGAGCATGTATTTGTGG + Intronic
1009720291 6:67459813-67459835 TTTAAGTCTGCATTTATCTGTGG - Intergenic
1009987535 6:70799757-70799779 TCTAAGCTTGTATGTTTTTAGGG + Intronic
1010835311 6:80579852-80579874 TCAAAGTTTGCATGGTCTTGTGG - Intergenic
1011832853 6:91394102-91394124 GCTAACTCTGCATTTGTTTGTGG + Intergenic
1012521420 6:100126021-100126043 TCTAGGTCTGGTTGCTTTTGGGG - Intergenic
1012765219 6:103358257-103358279 TCTAAGTGTGCCTGTCCTTGGGG - Intergenic
1013388308 6:109655113-109655135 TCTACTTCTGGGTGTTTTTGTGG + Intronic
1014844950 6:126263465-126263487 TGTCATTTTGCATGTTTTTGTGG - Intergenic
1017277434 6:152585911-152585933 TGTATGTGTGCATGTGTTTGGGG + Intronic
1017716063 6:157214132-157214154 TCTAACTCGGCATGTTATTTTGG - Intergenic
1018683116 6:166281429-166281451 TCTGAGACTGCAGGTCTTTGCGG + Intergenic
1019090899 6:169532801-169532823 TTTAAGTTTTCCTGTTTTTGGGG - Intronic
1021386674 7:20039419-20039441 CCTAAGTCTGGCAGTTTTTGAGG + Intergenic
1021572295 7:22078397-22078419 TTTCAGTCAGTATGTTTTTGGGG - Intergenic
1021763306 7:23922401-23922423 TCTAAACCTCCAGGTTTTTGTGG + Intergenic
1022147654 7:27561985-27562007 TCTGAGTCTTTATGTTTTAGGGG + Intronic
1022941237 7:35241941-35241963 TCTAAGTCTGCAAAATTTGGGGG + Intronic
1023681245 7:42690187-42690209 TGTCATTCTGCAAGTTTTTGAGG - Intergenic
1024300939 7:47887164-47887186 TCTATGTCTTCATGTATCTGTGG + Intronic
1024749772 7:52452047-52452069 TCAAAGTCTGGATATTTGTGAGG + Intergenic
1024805156 7:53130754-53130776 TCTAAGTGTGGCAGTTTTTGTGG - Intergenic
1027544375 7:79507924-79507946 TCTATGTCTGAATTTATTTGGGG + Intergenic
1027967465 7:85030368-85030390 ACTAAGTCTCCATTTTTTGGTGG - Intronic
1028928049 7:96381790-96381812 TCTAAATTTCCATTTTTTTGTGG - Intergenic
1030825768 7:114155882-114155904 TGTATGTCAGCATGTTTCTGGGG + Intronic
1031942689 7:127805978-127806000 TATCAGTCTGCATGTTTCTTTGG + Intronic
1032574618 7:133040132-133040154 TCTAAGTCTGCATGTTTTTGAGG - Intronic
1034042083 7:147888563-147888585 TCTTAATTTGCATGTTTTTTTGG - Intronic
1034962057 7:155368954-155368976 TCTGAGTCTTCCTGTTTCTGTGG + Intergenic
1036234336 8:7025256-7025278 TCTAAGTCTGCTGGATTTGGAGG - Intergenic
1037573172 8:20176013-20176035 TGTAAGACTTCCTGTTTTTGTGG - Intronic
1041719097 8:60960320-60960342 TGAGAGTCTGCTTGTTTTTGTGG + Intergenic
1045804704 8:106144917-106144939 TTTAAGTCTCCATGCATTTGTGG - Intergenic
1045906218 8:107348116-107348138 TCCAAGTCTGGCTGATTTTGTGG - Intronic
1046055738 8:109076046-109076068 TCTAATTCTTCTGGTTTTTGAGG - Intergenic
1048530815 8:135248409-135248431 TCCAAGCGTGCATGGTTTTGAGG + Intergenic
1048646344 8:136425261-136425283 TCTAAATCTGTGTATTTTTGTGG + Intergenic
1052602335 9:30650756-30650778 AATAAGTCTACATGTTTATGGGG + Intergenic
1053399518 9:37805516-37805538 TCTAAGTTTTTATGTATTTGGGG + Intronic
1053810628 9:41848367-41848389 TCTTACTCTACATGTCTTTGGGG + Intergenic
1054619965 9:67339072-67339094 TCTTACTCTACATGTCTTTGGGG - Intergenic
1055497692 9:76872010-76872032 TCTATGTATGCAGGTGTTTGTGG - Intronic
1056420275 9:86418789-86418811 ACTAAGTCTGGAAGGTTTTGGGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1059040427 9:110808852-110808874 TCTAAGTCTGGGTTTTTTTGTGG - Intergenic
1059448074 9:114351414-114351436 TCCACGTATGCATGTTTCTGGGG + Intronic
1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG + Intronic
1061597255 9:131639740-131639762 CCTAAATCTGCATCATTTTGGGG - Intronic
1189193857 X:39135126-39135148 TCTAGGTTTGCAGGTGTTTGTGG - Intergenic
1189585086 X:42451991-42452013 CCTAAGTGTGTATGTTTATGGGG - Intergenic
1189742258 X:44131819-44131841 TTTTAGTTAGCATGTTTTTGAGG + Intergenic
1190262031 X:48803248-48803270 TCTAAGTGTGTGTATTTTTGTGG - Intronic
1190728224 X:53206188-53206210 TCTCACTTAGCATGTTTTTGGGG - Intronic
1191946319 X:66538763-66538785 TGAAAGGCTGCAAGTTTTTGAGG + Intergenic
1192130431 X:68544663-68544685 TTTCACTCTGCATGTTCTTGCGG + Intergenic
1194866545 X:99075771-99075793 TCTCATTCTGCCTGTTTGTGAGG - Intergenic
1196557615 X:117107939-117107961 TCTAAGACTTCATGCTTTAGAGG - Intergenic
1197186991 X:123598659-123598681 ACTAACTCTGAATCTTTTTGGGG - Intergenic
1197486204 X:127054910-127054932 TCCAATTTGGCATGTTTTTGCGG + Intergenic
1198989431 X:142494516-142494538 TCTAAGTTTACATCTATTTGGGG - Intergenic
1200918369 Y:8591242-8591264 TTGATGTCTGCATGTGTTTGTGG + Intergenic
1202175475 Y:22095079-22095101 TGGATGTCTGCATGTTTGTGTGG - Intronic
1202215887 Y:22491304-22491326 TGGATGTCTGCATGTTTGTGTGG + Intronic