ID: 1032576375

View in Genome Browser
Species Human (GRCh38)
Location 7:133059411-133059433
Sequence ATGGAGGAGGAAAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032576365_1032576375 27 Left 1032576365 7:133059361-133059383 CCTAAAATTCCAGGGGACAAAGG 0: 1
1: 0
2: 0
3: 16
4: 262
Right 1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG No data
1032576367_1032576375 18 Left 1032576367 7:133059370-133059392 CCAGGGGACAAAGGTACTAATGT 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032576375 Original CRISPR ATGGAGGAGGAAAGTGAGGA GGG Intronic
No off target data available for this crispr