ID: 1032578060

View in Genome Browser
Species Human (GRCh38)
Location 7:133076612-133076634
Sequence GAGATGAGTGGGAAGACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578060_1032578063 -3 Left 1032578060 7:133076612-133076634 CCTACAGTCTTCCCACTCATCTC 0: 1
1: 0
2: 4
3: 22
4: 276
Right 1032578063 7:133076632-133076654 CTCTTCCTACCCACCTTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578060 Original CRISPR GAGATGAGTGGGAAGACTGT AGG (reversed) Intronic
901225331 1:7609927-7609949 GAAATGAGAGGGTAAACTGTGGG + Intronic
904810201 1:33158469-33158491 GTCATGAGTGAGAAGTCTGTGGG + Intronic
905027439 1:34860458-34860480 GAGATTAGTGGGATGAGGGTGGG - Intergenic
905403322 1:37718055-37718077 GGGATGGGAGGGAAGACAGTGGG - Exonic
905622547 1:39461328-39461350 GAGTTGAGTGGTAGGACTGTGGG + Intronic
907527135 1:55060336-55060358 GAGAGGTCTGGGAAGACAGTGGG + Intronic
908494327 1:64679504-64679526 GAGATGGGAGGGAATACAGTGGG - Intronic
909055887 1:70820612-70820634 GGGGTGGATGGGAAGACTGTGGG + Intergenic
909238990 1:73188293-73188315 GAGATGGCTGGCAAGCCTGTGGG + Intergenic
909496197 1:76281561-76281583 AAGATCACTGGGAAGAGTGTCGG + Intronic
912233545 1:107823011-107823033 GATATAATAGGGAAGACTGTGGG + Intronic
912382691 1:109255813-109255835 GAGAGCAGTGGGTTGACTGTTGG + Intronic
913001949 1:114589457-114589479 GAGATGAGAAGGAAGGGTGTTGG - Intronic
914684588 1:149967252-149967274 GAGAGTAGAGGGAAGAGTGTGGG + Intronic
915270294 1:154749061-154749083 GAGATGAGTGGAGAGACTGGTGG + Intronic
915350063 1:155218682-155218704 GAAATGGGTGGGAAGAGTGGTGG - Intergenic
915353461 1:155240920-155240942 GAAATGGGTGGGAAGAGTGGTGG - Intronic
915358737 1:155273041-155273063 GAGATGAGGGGGAAGGAGGTCGG - Intronic
916551564 1:165854747-165854769 GAGTTAAGTGGGAAGAGTGGGGG - Intronic
918535741 1:185572628-185572650 TGGATAAGTGGGAAGACAGTAGG + Intergenic
920244951 1:204580418-204580440 GGCATGAGTGGGAGGAATGTAGG - Intergenic
920864793 1:209743083-209743105 GAGCTGAGTGGAAAGACAGAAGG - Intergenic
921240217 1:213172679-213172701 GAGAAGAGTTGTGAGACTGTGGG + Intronic
1068796660 10:61089708-61089730 CAGATGAGTCTGAAGACTGTTGG - Intergenic
1068933247 10:62612620-62612642 GAAATGGGTGGGAAGGCAGTTGG + Intronic
1069170362 10:65220518-65220540 GAGATGAGTAAGAATTCTGTTGG - Intergenic
1070189513 10:74098874-74098896 GAGGTAACTAGGAAGACTGTAGG - Intronic
1071505225 10:86227957-86227979 TAGATGGGTGGGCAGACTGATGG + Intronic
1072622519 10:97089517-97089539 AAGATGAGTGTGAAGCCTGCAGG + Intronic
1072631800 10:97151486-97151508 GAGATGGGTGGGTTGACTGATGG + Intronic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1073937065 10:108645730-108645752 GGGCTGAGTGGGGAGACTATGGG + Intergenic
1074490146 10:113932714-113932736 GGGATGAGTGGGAAGAAGCTTGG - Intergenic
1075698952 10:124456066-124456088 GAGAAGGTTGGGAAGAGTGTAGG - Intergenic
1075706077 10:124502218-124502240 GCCATGAGTGGGATGACTGGTGG - Intronic
1077296010 11:1826611-1826633 GAGATGAGCGGGCAGGCTATGGG - Intergenic
1078773980 11:14377207-14377229 GAGGTGAGGGTGAAGACTCTAGG + Intergenic
1079041355 11:17063249-17063271 GACATGAATGGGAATACTGCTGG - Intergenic
1079100752 11:17540535-17540557 GAGGTGACTGAGAAGGCTGTAGG - Intronic
1081522510 11:43896739-43896761 GAGATCAGTGGTAATATTGTTGG + Intronic
1083631858 11:64099657-64099679 GAGATGAGTGGATAGATTGATGG + Intronic
1083756349 11:64793679-64793701 GAGGAGAGTGGGAGGAATGTGGG - Intronic
1084081426 11:66828161-66828183 GAGATGAGGAGGCAGACAGTAGG - Intronic
1084472187 11:69369156-69369178 GACATGAGTGGAAACACTGGTGG - Intergenic
1085590036 11:77751723-77751745 GAGAGGAGTGGGAGGAATGGGGG - Intronic
1085596991 11:77820079-77820101 GAGATGGTCGGGAAGACTGGTGG + Intronic
1086184110 11:83992774-83992796 GAGATGAATGCTAAGATTGTAGG + Intronic
1087873470 11:103327036-103327058 GTGATGAGTGAGGAGACTGAGGG - Intronic
1087955046 11:104275929-104275951 GATATGAATGGGAAGAGGGTGGG + Intergenic
1088550621 11:111009242-111009264 GATACCAGTGAGAAGACTGTCGG + Intergenic
1090438299 11:126704977-126704999 GACAGGAGTGGGAGGACTCTTGG + Intronic
1091269150 11:134293425-134293447 GAGATGAGTGGGAAGGGCGAGGG + Intronic
1092267772 12:6996118-6996140 GAGATGAGTCAGAGGACAGTGGG - Intronic
1092447780 12:8573695-8573717 GAGAAGAATGGGAATACAGTTGG + Intergenic
1092902570 12:13073677-13073699 GGGATGGGTGGCAAAACTGTTGG - Intronic
1092928867 12:13296441-13296463 GACATGAGTGGTATGAGTGTGGG + Intergenic
1093335093 12:17895287-17895309 GAGATGAATAGAAAGAATGTAGG + Intergenic
1097341171 12:58439827-58439849 GTAATGAGTGGGAATAATGTTGG + Intergenic
1097920905 12:65072280-65072302 AAGTTGAGTGGGAGGACAGTAGG - Intronic
1098405370 12:70120452-70120474 GATCTGAGTGGTAAGAGTGTAGG + Intergenic
1098480415 12:70951732-70951754 CAGATGACTGGGAAAACTGTTGG - Intergenic
1098902041 12:76120406-76120428 AAGATGAGTGGGAAGATTTGGGG - Intergenic
1098971613 12:76863156-76863178 GAGGTGAGTTGGGAGACCGTTGG - Exonic
1101379832 12:104205053-104205075 GAGATGGGTGGGAAGCCAGAAGG + Intergenic
1101597545 12:106180356-106180378 CAGAAGTGGGGGAAGACTGTGGG + Intergenic
1102450577 12:113039079-113039101 GGGCTCAGTGGGAAGACTTTGGG - Intergenic
1102531737 12:113551686-113551708 GAGATGAGTGGTGAGAGAGTGGG - Intergenic
1102538572 12:113601096-113601118 GAGAGGAGGGGGCAGACTGAGGG + Intergenic
1102581603 12:113891883-113891905 GAAATGAGCGGGAAGACAGAGGG - Intronic
1106317184 13:28604951-28604973 GAGAGGAGAGGGAAGACTAAGGG + Intergenic
1106585243 13:31051585-31051607 GAGAGGAGTGGAAAGAAGGTAGG - Intergenic
1107391339 13:39967766-39967788 CAGATGAGCTGGAAGACAGTTGG - Intergenic
1108731702 13:53242153-53242175 GATCTGAGAGGGAAGTCTGTGGG - Intergenic
1110745374 13:79047381-79047403 GAGGAGAGTGGGGAAACTGTAGG - Intergenic
1111254507 13:85648552-85648574 GAGCTGAGTGGGGAGAGTATGGG - Intergenic
1111921104 13:94411957-94411979 GAGATGAATCAGAAGACTGTTGG - Intergenic
1112258106 13:97852950-97852972 TAGATGGGTGGGTAGATTGTTGG + Intergenic
1114402712 14:22424636-22424658 GAGAGGATTGGGAAGACACTTGG - Intergenic
1117512162 14:56463461-56463483 GAGAGCAGTGGGAATTCTGTAGG + Intergenic
1118744120 14:68761784-68761806 GAGAAGAATGGGCAGACTGGAGG - Intergenic
1119513022 14:75226689-75226711 GAGGTGAGTGGGAAGAGAGAAGG + Intergenic
1119887543 14:78155582-78155604 GAGATGAGAAGGAAGAGTGGGGG - Intergenic
1120015840 14:79472288-79472310 CAGATGAGTGGGAAGACTTTAGG - Intronic
1120249827 14:82049834-82049856 GAGAGGAATGGGAAGACTGGTGG + Intergenic
1121547953 14:94776300-94776322 GAGATAAGTTGGGAGACTGAGGG + Intergenic
1121967142 14:98320889-98320911 GAACTTAGTGGGAAGTCTGTAGG - Intergenic
1126269066 15:46791487-46791509 CAAATGAGTGGGAAAACTGAAGG + Intergenic
1126541087 15:49824977-49824999 GTGATGAGTGGGTAGCCTGCAGG - Intergenic
1127297126 15:57618521-57618543 AAGAGGAATAGGAAGACTGTGGG + Intronic
1127590785 15:60420573-60420595 GAGATGAGAGAGAAAACTGCAGG - Exonic
1128536341 15:68493472-68493494 AAGATGAGAGGGAAGTATGTTGG + Intergenic
1131155441 15:90072446-90072468 GAGATGAGTGGATAGGCTCTGGG + Intronic
1132372012 15:101306034-101306056 GAGCTTAGGAGGAAGACTGTAGG + Intronic
1134866029 16:17607933-17607955 GAGAGGAATGGGAAGATTGGGGG - Intergenic
1135128824 16:19834944-19834966 TAGATGAATGGGAAAACTATGGG - Intronic
1135263552 16:21001662-21001684 AAGGTTACTGGGAAGACTGTAGG - Intronic
1136220405 16:28824094-28824116 GGGATGACTGGGAGGACTGCGGG + Intronic
1137390704 16:48079100-48079122 CATATGAGGGGGAAGTCTGTTGG - Intergenic
1137694246 16:50450594-50450616 GAGATGTGGGGAAAGAGTGTGGG - Intergenic
1137741385 16:50779492-50779514 GAGAGGAGCGAGAACACTGTTGG + Intronic
1138740699 16:59306063-59306085 CAGATGAGAGGGAAGATTGAAGG - Intergenic
1140213556 16:72989660-72989682 GAAATAAGTGGGAAGAATATGGG + Intronic
1140701301 16:77583946-77583968 GTGACCAGTGGAAAGACTGTAGG + Intergenic
1142507007 17:370889-370911 GAGATGAGTTGCGGGACTGTAGG - Intronic
1143377009 17:6472830-6472852 GGGGTGAGTGGGAAGACAGAGGG + Intronic
1143421625 17:6797603-6797625 GTGATGAGTGGGAATTCTCTCGG - Intronic
1143583293 17:7838650-7838672 GAGCAGAGTGGGCAGACTTTAGG - Intergenic
1144188168 17:12815831-12815853 GAGATGAGCAGGCAGTCTGTAGG + Intronic
1144811126 17:17999522-17999544 GGGATGAGTGGGAGGAGCGTAGG - Intronic
1145776193 17:27530731-27530753 GATCTGAGTGGGAAGGCTATAGG - Intronic
1147335298 17:39723872-39723894 GATATGAGTGAGAAGAGCGTGGG - Intronic
1148105729 17:45117943-45117965 GAGGTCATTGGGAAGGCTGTGGG + Intronic
1148759936 17:49994409-49994431 GAGAGGAAGGGGAAGGCTGTGGG - Intronic
1149755194 17:59180437-59180459 GAGGTGTGTGGGAAGAATGGAGG - Intronic
1150034841 17:61783385-61783407 GTGATGAGGGGAAAGACTCTAGG + Intronic
1151144147 17:72024009-72024031 GAGATGAGAGGCAATACTTTTGG + Intergenic
1151166580 17:72209124-72209146 GAGATAAATGGTAATACTGTGGG + Intergenic
1151354269 17:73549225-73549247 GAGAGGAGTGGGAAGAGAGGAGG + Intronic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1151804248 17:76395945-76395967 GCGGCGAGTGGGAAGTCTGTGGG - Intronic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1158122198 18:54060849-54060871 TAGATGAGTGGGAGGAGTGTCGG - Intergenic
1158308972 18:56138749-56138771 GGGATGAGTGGGAAGGGAGTGGG + Intergenic
1158827810 18:61243156-61243178 TAGGTGAGTGGGAAGACTAAGGG - Intergenic
1158885251 18:61820798-61820820 CAGCAGAGTGGGAAGACTGGAGG + Intronic
1159295688 18:66484761-66484783 GAGATGATGGGCAAGATTGTTGG - Intergenic
1160069360 18:75611821-75611843 GAGAAGAGTTGGCAGAGTGTCGG - Intergenic
1160921560 19:1523295-1523317 CAGCTGGGTGGGAAGACAGTGGG - Intergenic
1161249363 19:3271842-3271864 GAGCTCAGTGGGGAGACTTTGGG + Intronic
1161428343 19:4216719-4216741 GAGAAGAGGGGGCAGCCTGTGGG + Exonic
1161753705 19:6115824-6115846 GACATGAGTGGGTGGACTGAGGG + Intronic
1163718780 19:18887957-18887979 TCTATGAGTGGGATGACTGTAGG + Intronic
1165505901 19:36229253-36229275 GAGATGAGTGAGAAGACAACGGG - Intronic
1167151678 19:47713701-47713723 GGGAGGAGTGGGAAGAGTGGGGG - Intronic
1167239014 19:48332255-48332277 TAGATGAGTGGGATGGCTGCAGG - Intergenic
926599667 2:14828646-14828668 GTGATGAGTTGGGAGGCTGTTGG + Intergenic
927200839 2:20577246-20577268 GAGCTGAGTGGGGAGAGGGTGGG + Intronic
928281289 2:29948537-29948559 GAGTCGAGTGGGAAGGTTGTAGG - Intergenic
928953327 2:36834682-36834704 GAGATATGTGGGAAGTCTGTTGG + Intergenic
929289924 2:40178383-40178405 GAGATGAGTGAGAAGAAAGGTGG - Exonic
929872852 2:45773184-45773206 GAGCAGAGTTGGAAGACTGTGGG - Intronic
931322723 2:61187308-61187330 GAGAGGATTGAGAAGTCTGTGGG + Exonic
931861356 2:66358001-66358023 GAGATGAATGGGAATACTCTGGG - Intergenic
933274077 2:80265379-80265401 GACATGAGTTGGGAGGCTGTTGG + Intronic
933971891 2:87476565-87476587 GAGATGAGTGGAAAGATTTTAGG + Intergenic
934108150 2:88715219-88715241 GAGATGATTGGAAAGAGTGCAGG + Intronic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
935718295 2:105958035-105958057 GAGATGAGTTGGAAAGCTGGTGG - Intergenic
936018249 2:108975537-108975559 GAGGTGGGTGGGTGGACTGTAGG + Intronic
936321835 2:111473636-111473658 GAGATGAGTGGAAAGATTTTAGG - Intergenic
938441613 2:131339863-131339885 TGGAAGAGTGGGAAGATTGTGGG + Intronic
942761183 2:179400007-179400029 GAGAAGAGTGAGGAGACTCTTGG - Intergenic
946409755 2:219510133-219510155 GAGATAAGTGGGAAAAGTGAGGG - Intergenic
947679795 2:232020074-232020096 GAAATGAGAAGGAAGCCTGTTGG + Intronic
948839826 2:240643409-240643431 GGGCGGAGTGGGGAGACTGTGGG - Intergenic
948868666 2:240787563-240787585 GAGATGGCTGGGATGTCTGTAGG - Intronic
1169331941 20:4723017-4723039 GAGATGAAAGGGAAGACAGGAGG - Intronic
1170153955 20:13252856-13252878 GAGAGAAGTGGGAAGACAGAAGG - Intronic
1170158561 20:13290195-13290217 GAGCTGAGTTGGAAGCCTGGTGG + Intronic
1171003805 20:21442860-21442882 CAGATCAGTGGTAAGACTGGGGG + Intergenic
1173843340 20:46173377-46173399 TCCATGAGTGGGAAGACTGATGG + Intergenic
1177182988 21:17763565-17763587 GAGATGAGCTGGAAGTCTGGTGG + Intergenic
1177325625 21:19584717-19584739 GAGCAGAGTGGGAAGAGTGAGGG - Intergenic
1178098988 21:29245552-29245574 GAAAGGAGTGGGAAGAGAGTGGG - Intronic
1180000216 21:44992230-44992252 GAGCTGAGTGGGAAGATTTTTGG - Intergenic
1180501785 22:15936340-15936362 AAGATCAGTGGGAGGACTTTTGG + Intergenic
1181098532 22:20522863-20522885 CAGATGTGAAGGAAGACTGTGGG + Intronic
1181120884 22:20668313-20668335 TAGCTGAGTGGGGAGACTGGAGG - Intergenic
1182301589 22:29340177-29340199 GAGGGGAGTGGGAAGACAGTAGG - Intronic
1184639439 22:45861467-45861489 GAGATGAATGGTACGCCTGTGGG + Intergenic
1184952994 22:47858920-47858942 GAGGAGAGTGTGAAGATTGTGGG + Intergenic
950915290 3:16638356-16638378 GAGAGTAGTGGGAAAACTGCAGG - Intronic
951101813 3:18697025-18697047 GAGATGAGATAAAAGACTGTTGG - Intergenic
952140439 3:30473034-30473056 GAGAAGAATGGGAAAACTCTAGG + Intergenic
953496902 3:43395057-43395079 GAGGTGAGAGGGAAGAGGGTGGG + Intronic
954806268 3:53222713-53222735 GAGAGGAGGGTGAAGGCTGTTGG - Intergenic
954916351 3:54151331-54151353 GAGATGAGTGGATAGATAGTTGG + Intronic
956868557 3:73393196-73393218 GCGAGCAGTGGGAAGATTGTAGG + Intronic
956876961 3:73473433-73473455 CAGAGGAATGGGAAGATTGTTGG + Intronic
958887596 3:99744625-99744647 GAGATAATTGGAAAGACTTTGGG - Intronic
959102871 3:102033385-102033407 GAGATGAATGTGATGACTGATGG + Intergenic
961088672 3:124091405-124091427 GAGATGAGTGGGAAAGATTTGGG + Intronic
961424372 3:126833532-126833554 GTGGCGAGTGGGAAGAATGTGGG + Intronic
961925243 3:130472398-130472420 GAGATCTGTGTGGAGACTGTGGG + Intronic
963258453 3:143169671-143169693 GAGACCAGTGAGAAGACAGTGGG - Intergenic
966272577 3:178125502-178125524 CAGATGAGTGAGATGAGTGTAGG + Intergenic
966338304 3:178896207-178896229 GACAGGAGAGGCAAGACTGTAGG + Intergenic
967902295 3:194467082-194467104 TACAGGAGTGGGAAGTCTGTAGG - Intronic
968938075 4:3624051-3624073 GAGGGGAGTGGGAAGGCTGCGGG - Intergenic
970118249 4:12723428-12723450 TAAATGAGCTGGAAGACTGTGGG - Intergenic
970989022 4:22191446-22191468 GAGATGAATGGGAAGCCAGAAGG - Intergenic
971505246 4:27359285-27359307 GAGATAACTGGGAAGACAGATGG + Intergenic
971723413 4:30276266-30276288 GAGATGAGTGAAATGACTGCTGG + Intergenic
971956594 4:33427984-33428006 GAGATGAGTGGAAGAACAGTGGG + Intergenic
972009078 4:34152391-34152413 GAGATGAGTGTGAGGTATGTGGG + Intergenic
973307289 4:48667197-48667219 GAGATGAGTGGAAGGCATGTAGG + Intronic
977395585 4:96467502-96467524 GAGATATGTTGGAAGAATGTTGG + Intergenic
977406618 4:96607929-96607951 GAGATGAGAGGGAATAATTTTGG - Intergenic
978590325 4:110317401-110317423 GGAATGACGGGGAAGACTGTGGG + Intergenic
980003724 4:127517471-127517493 TAAAGGAGTGGGAAGACTCTGGG + Intergenic
980095015 4:128480627-128480649 GAGATGAGTGGGTATTTTGTTGG + Intergenic
981875121 4:149532941-149532963 GAGGTCAGTGGGAAGACAGCAGG + Intergenic
984315640 4:178127998-178128020 TAGTTAAGTGGGAAAACTGTTGG + Intergenic
984318291 4:178157549-178157571 GAAATGAATGTGAAGTCTGTGGG + Intergenic
986125146 5:4877561-4877583 GACTTGAATGGGAAAACTGTAGG + Intergenic
986859147 5:11905181-11905203 GAGATGCACTGGAAGACTGTGGG - Intergenic
987322178 5:16780504-16780526 GAGGTGAGTGGGACGACAGCTGG - Exonic
987447500 5:18038486-18038508 CAGAGGAGAGGGAAGACTGATGG - Intergenic
990210973 5:53481010-53481032 GAGAGGAGTGGGAAAATTGTAGG + Intronic
991460461 5:66852896-66852918 GAGCTGAGGAGGAAGACTGTAGG + Intronic
992244250 5:74802276-74802298 GATATGAGTGAGGAGGCTGTTGG - Intronic
994087773 5:95779165-95779187 GAGATGTGTGGGTAAACTCTTGG + Intronic
995299928 5:110567633-110567655 GAGAGGAGAGGGAAGAGTCTTGG + Intronic
995347197 5:111134455-111134477 GAGCTGGGTGGGGAGGCTGTCGG - Intergenic
998805578 5:145915107-145915129 TAGATGGGTGGGGAGCCTGTGGG - Intergenic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1003177147 6:3760894-3760916 GGGATGAGATGGAAGACTGGGGG - Intergenic
1003797360 6:9619614-9619636 TAGATGAGTGGAAACACTGCTGG - Intronic
1004831403 6:19480619-19480641 GAGATGACTGGGAGCAATGTAGG - Intergenic
1005634856 6:27743832-27743854 GAGGGGAGTGGGAAGAATCTGGG - Intergenic
1006056542 6:31389451-31389473 GTGAGGGGTGGGAAGACTGAGGG + Intergenic
1006069267 6:31486430-31486452 GTGAGGGGTGGGAAGACTGAGGG + Intergenic
1006189473 6:32198793-32198815 GAGAGGGGTGGGAAGCCTGCTGG - Intronic
1006980048 6:38140270-38140292 AAGAAGAGTGTGAAGAGTGTAGG + Intronic
1008481741 6:51993188-51993210 GAGGTGAGTGGGGAGAATGTTGG + Intronic
1010122979 6:72400654-72400676 GAGATGACTGGGAAGCCCGCCGG - Exonic
1010472485 6:76245088-76245110 GAGGATAGTGGGAGGACTGTAGG - Intergenic
1011718980 6:90135611-90135633 GAGCTGAGTAGGAGGACTGCTGG + Intronic
1012711114 6:102606730-102606752 GAGATAAGTGGGGAGCCAGTTGG + Intergenic
1012851394 6:104450191-104450213 GAGATGAGAGGCAAGTCTGTAGG - Intergenic
1014136017 6:117890789-117890811 GAGGTGAGTGGGAGGAGTTTGGG + Intergenic
1014404796 6:121037827-121037849 GAAATGAGTAGGAAGGCTGGAGG - Intergenic
1015011994 6:128360394-128360416 GAGTTGAGTAGGAAAAGTGTTGG - Intronic
1015199977 6:130568331-130568353 GAGGTGAGGGGCAAGACTGAGGG + Intergenic
1015411744 6:132901241-132901263 GAGATTAGTGGGAAATCTGATGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1020679702 7:11221168-11221190 GAGCAGGTTGGGAAGACTGTAGG + Intergenic
1021452598 7:20797123-20797145 GAAATGGGTGGGAAGATTGTAGG + Intergenic
1021581781 7:22161859-22161881 GAGATGATTAGTAAGACAGTTGG - Intronic
1021940229 7:25671753-25671775 GCTATGAGTGGGGAGACTCTTGG + Intergenic
1022424246 7:30253089-30253111 GCAAGGAGTGGGAAGCCTGTTGG - Intergenic
1022446147 7:30472297-30472319 GAGGTGAATGGGAAGGATGTGGG - Intronic
1023228611 7:37999820-37999842 GAGTTCAATGGGAAGACAGTGGG + Intronic
1024278501 7:47698437-47698459 CAGAAGAGTGGGAAGACAGAAGG + Intronic
1024814944 7:53257477-53257499 GAAATGAGTTGAAAGACTTTGGG + Intergenic
1025963097 7:66241233-66241255 GAGATGATTGGGAAAGCTGGGGG + Exonic
1028231157 7:88307530-88307552 GAGATCATTGGGAAGACTCTGGG - Intergenic
1032398834 7:131609816-131609838 GAAATGAGTGTGAAGAATGCTGG - Intergenic
1032515685 7:132504425-132504447 GAGTTCAGGGGGAAGAATGTGGG + Intronic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1033406072 7:141072831-141072853 GAGATGAATGGGGAGAGGGTGGG - Intergenic
1033602096 7:142895881-142895903 TAGATGAGAGAGAAGAGTGTGGG + Intergenic
1034277230 7:149829260-149829282 GGGATGACTGAGGAGACTGTGGG - Intergenic
1034277346 7:149829647-149829669 GGGATGACTGAGGAGACTGTGGG - Intergenic
1034277496 7:149830132-149830154 GGGATGACTGAGGAGACTGTGGG - Intergenic
1034277541 7:149830283-149830305 GGGATGACTGAGGAGACTGTGGG - Intergenic
1034697246 7:153064696-153064718 GAGATGGGTGGGAGGATTGGTGG - Intergenic
1035863404 8:3054857-3054879 CAGATCTGTGGGAAGACTGTTGG + Intronic
1036208177 8:6820359-6820381 GAGATGGTTGGGAAGAATGAAGG + Intronic
1039583109 8:38682973-38682995 GAGATGAGTGAGAGGAGCGTGGG - Intergenic
1040328984 8:46376399-46376421 GATAGGAGTGGGAGGGCTGTAGG + Intergenic
1040334632 8:46409809-46409831 GGGATAAGTGGCAAGACTGCAGG + Intergenic
1041166359 8:55096501-55096523 GAGTTCAGTGGGAAGTGTGTAGG - Intergenic
1043121343 8:76328974-76328996 AAGATGAGTGGTGAGAGTGTGGG + Intergenic
1045357929 8:101405762-101405784 GAGATGAGAGGGAAGAGGGAAGG - Intergenic
1047455013 8:125000307-125000329 AAGATGAGGGGGAAGAGTTTAGG + Intronic
1047787507 8:128168118-128168140 GTGAGGAGTGGAAAGAATGTGGG + Intergenic
1047960544 8:130008496-130008518 GACATGTGTGGGGTGACTGTGGG + Intronic
1048140983 8:131793985-131794007 GAGATGGGAGGGAAGAGTCTGGG + Intergenic
1049400623 8:142425249-142425271 GAGATGAGGAGGAACAGTGTGGG + Intergenic
1051693355 9:19741296-19741318 GAGGGAAGTGGGAAGCCTGTAGG + Intronic
1053535374 9:38920334-38920356 GAGATGAGTGGGAAGACTCAGGG - Intergenic
1054207595 9:62144738-62144760 GAGATGAGTGGGAAGACTCAGGG - Intergenic
1054453097 9:65413655-65413677 GAGGGGAGTGGGAAGGCTGAGGG + Intergenic
1054630757 9:67443616-67443638 GAGATGAGTGGGAAGACTCAGGG + Intergenic
1055006927 9:71518294-71518316 GAGATCAGTAGGCAGTCTGTAGG + Intergenic
1056115683 9:83439080-83439102 GTGATGAGTGTCAAGACTCTGGG - Intronic
1056684741 9:88750278-88750300 TGGATGACTGGGAACACTGTTGG + Intergenic
1057717676 9:97507781-97507803 AAGATGAATGGGAGGACTCTTGG + Intronic
1058485466 9:105439563-105439585 GACATGAGTGGGAGGAGTCTGGG - Intergenic
1059321492 9:113473899-113473921 GAGATGTGTGTGAATCCTGTAGG + Intronic
1062017200 9:134296890-134296912 GAGCTCAGTGGGGGGACTGTGGG - Intergenic
1062128550 9:134880180-134880202 GAGAAGAGTGGGGAGCCTGGGGG - Intergenic
1062533743 9:137012687-137012709 GAGCTGGGTGGGGAGGCTGTGGG - Intronic
1187993657 X:24902647-24902669 AAGAGGAGAGGGAAGACTGGTGG - Intronic
1190637346 X:52449064-52449086 GAGATGAGTGTCAAGACTATAGG - Intergenic
1191226376 X:58048759-58048781 GAGAAAGGTGGGAAGACTGATGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193000645 X:76558770-76558792 GAGAGGAGAGGGAAGAGTGGGGG - Intergenic
1194329084 X:92559097-92559119 TAGATGTGTGGGAAGACATTTGG + Intronic
1195920507 X:109978679-109978701 GAGATCAGCTGGAAGGCTGTTGG + Intergenic
1196197192 X:112848547-112848569 GCGAAGAGTGGGAAGAGAGTGGG - Intergenic
1196233556 X:113253357-113253379 GAGATGAGAGGGAAGAGTTGGGG - Intergenic
1197010647 X:121558582-121558604 GAGATGAGAAGAAAGACAGTAGG + Intergenic
1198263484 X:134987681-134987703 CAGATGGGTGGGATGACTGGTGG - Intergenic
1198937156 X:141910584-141910606 GAGAGGAGTGGGGACAGTGTGGG - Intergenic
1198961895 X:142192281-142192303 GAGAGGAGTGGGGACAGTGTGGG + Intergenic
1199596531 X:149510362-149510384 AAGAAGAGAGGGAAGACGGTGGG - Intronic
1199743244 X:150755530-150755552 GCCATGAGTGGGAAGAAGGTGGG + Intronic
1199966058 X:152821993-152822015 TGGATGAGTGTGAATACTGTAGG + Intergenic
1200132041 X:153855162-153855184 GAGATGATTACAAAGACTGTTGG - Intergenic