ID: 1032578563

View in Genome Browser
Species Human (GRCh38)
Location 7:133081843-133081865
Sequence GGCATCCGGGTGAGTGCCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578563_1032578570 18 Left 1032578563 7:133081843-133081865 CCACGGGCACTCACCCGGATGCC 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34
1032578563_1032578574 30 Left 1032578563 7:133081843-133081865 CCACGGGCACTCACCCGGATGCC 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48
1032578563_1032578571 26 Left 1032578563 7:133081843-133081865 CCACGGGCACTCACCCGGATGCC 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25
1032578563_1032578573 29 Left 1032578563 7:133081843-133081865 CCACGGGCACTCACCCGGATGCC 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578563 Original CRISPR GGCATCCGGGTGAGTGCCCG TGG (reversed) Exonic
900230652 1:1555384-1555406 GGCATCTGGGTCAGAGCCCTGGG - Intronic
900983742 1:6061085-6061107 GGCTTCCGGCTCAGTGCCTGGGG - Intronic
905200102 1:36309582-36309604 GGGAATCAGGTGAGTGCCCGGGG + Exonic
922742767 1:228023842-228023864 GGCAGGCGGGTGGGTGCCAGGGG - Intronic
1063599455 10:7467052-7467074 GGCATCTGGGAGAGTCCACGTGG - Intergenic
1065569893 10:27059768-27059790 GGCATGGTGGTGTGTGCCCGGGG + Intronic
1066010618 10:31190847-31190869 GGCATCCAGGCAAGTGCCCAAGG - Intergenic
1067111781 10:43406553-43406575 GGCGTGCTGGAGAGTGCCCGTGG + Intronic
1067442620 10:46318113-46318135 GGCCTCAGTGTTAGTGCCCGGGG + Intronic
1076818392 10:132925846-132925868 GGCGTGCGGGTCAGTGCCAGAGG - Intronic
1077082577 11:731038-731060 GGCGTGCTGGTGAGTGCCTGTGG + Intergenic
1077299632 11:1840998-1841020 GGGAGCCGGGTGGGAGCCCGAGG - Intronic
1079198600 11:18354946-18354968 GGCATGGTGGTGAGTGCCTGTGG - Intronic
1080728064 11:34916807-34916829 GGCTTCGGGGTGAGTGGCCGGGG + Exonic
1086099439 11:83083498-83083520 GGCATCGTGGTGTGTGCCTGTGG + Intergenic
1090347240 11:126081401-126081423 GCCATGGTGGTGAGTGCCCGTGG - Intergenic
1093239256 12:16649193-16649215 GGCATGGTGGTGTGTGCCCGTGG - Intergenic
1096026948 12:48374656-48374678 GGCATCTGAGTGGGTGCCAGGGG - Intergenic
1101886801 12:108671194-108671216 GGCATGGTGGTGAGTGCCTGTGG + Intronic
1105817268 13:24048009-24048031 GGCATCAGGGAGAGTGACCTTGG - Intronic
1105953575 13:25257059-25257081 GGCATCCGTGGGAGTGGCCAGGG - Intronic
1108589111 13:51896562-51896584 GGCATCCGGCTGGGTGCATGGGG - Intergenic
1110028485 13:70572889-70572911 GGCATGGGGGTGAGCGCCTGTGG - Intergenic
1118252364 14:64173736-64173758 GGCATTCTGGTGAGTGCCTGTGG - Intronic
1123934579 15:25187988-25188010 GGCATTCGGGTCAGTTCCTGAGG - Intergenic
1127606599 15:60592759-60592781 GGCGCCCGGGCGAGGGCCCGGGG - Intronic
1128268251 15:66286054-66286076 GGCATGCTGGTGTGTGCCTGTGG + Intergenic
1128529499 15:68434043-68434065 GGCATGCTGGTGGGTGCCCCAGG + Intergenic
1132273916 15:100549977-100549999 GGCATGCTGGTGGGTGCCTGTGG - Intergenic
1134043541 16:11085363-11085385 TGCTTCAGGTTGAGTGCCCGTGG + Intronic
1135568029 16:23527100-23527122 GGCATCGTGGTGGGTGCCTGTGG - Intronic
1135703714 16:24656001-24656023 GGCATGGTGGTGAGTGCCTGTGG + Intergenic
1136090281 16:27914661-27914683 GGCATGGTGGTGAGTGCCTGGGG - Intronic
1136546333 16:30957170-30957192 CCCATCCGGGTGAGTCCTCGTGG + Intergenic
1137588921 16:49681679-49681701 GGCACCTGGGGGAGTGGCCGAGG - Intronic
1142467835 17:146231-146253 GGCCTCCGGGTGCTTGCTCGTGG - Intergenic
1146262840 17:31433004-31433026 GGCATTCTGGTGTGTGCCTGTGG + Intronic
1147386563 17:40085970-40085992 GGCATGGGGGTGTGTGCCTGTGG + Intronic
1149868424 17:60163004-60163026 AGCATCCGGGTGGGAGCCAGGGG + Intronic
1150311076 17:64129962-64129984 GGCCTCGGGGTGAGTGACCGGGG - Exonic
1151352785 17:73541530-73541552 GGTAGAGGGGTGAGTGCCCGTGG + Intronic
1162810424 19:13161373-13161395 GGCATCGTGGTGTGTGCCTGGGG - Intergenic
1162889975 19:13725687-13725709 GGCATGCTGGTGCGTGCCTGTGG + Intergenic
1165475158 19:36026286-36026308 GGGTTCCGGGTGAGCGCCTGTGG + Intronic
1165696060 19:37901851-37901873 GGCATGGGGGTGTGTGCCTGTGG - Intronic
1166902574 19:46077168-46077190 GGCACCCGGGTGAACGCCCACGG - Intergenic
1167915218 19:52734852-52734874 GACATCCCCGTGAGAGCCCGAGG - Intronic
1168257126 19:55173256-55173278 GGCATCTGGGTGTGTCCGCGAGG + Exonic
925046832 2:778613-778635 GGCATGGGGGTGAGTGCAGGTGG - Intergenic
928041360 2:27881107-27881129 GGCATGCTGGTGTGTGCCTGCGG + Intronic
929053832 2:37859191-37859213 GGAGCCAGGGTGAGTGCCCGTGG + Intergenic
931467716 2:62506016-62506038 AGGGTCCGGGTGAGTGACCGAGG - Exonic
936588852 2:113783688-113783710 GGCATGGTGGTGTGTGCCCGTGG + Intergenic
941382741 2:164815784-164815806 GGAATCTGGGTGAGTGCTTGAGG - Intronic
948485462 2:238278207-238278229 GGCATGGTGGTGAGTGCCTGTGG - Intronic
1169243696 20:4007774-4007796 GGCATGCTGGTGTGTGCCTGTGG + Intronic
1171348273 20:24483222-24483244 TGCATGCGTGTGAGTGCCCACGG - Intronic
1174619706 20:51864687-51864709 GGCATCCTGGTGAGTCCTGGTGG + Intergenic
1174717281 20:52773258-52773280 GGCATGGTGGTGAGTGCCTGTGG - Intergenic
1175869844 20:62203689-62203711 GGTAGACGGGTGGGTGCCCGGGG - Intergenic
1179107364 21:38414467-38414489 GGCATCTGTGAGAGTGCCCTGGG - Intronic
1179258190 21:39736109-39736131 GGCAGCAGGGTGGGTGCCAGGGG - Intergenic
1179597897 21:42455350-42455372 GGCATCCTGGTGAGTGGACCAGG + Intergenic
1179944931 21:44666772-44666794 GGCATCCTGCTGTGTGCCTGTGG - Exonic
1180957636 22:19747992-19748014 GGCATCAGGGTGAGTGACACTGG + Intergenic
1181276291 22:21689117-21689139 GGCATTCGTGTGGGTGCCTGTGG + Intronic
1182901882 22:33905201-33905223 GGCATCCTGGTGCATGCCTGTGG - Intronic
950365244 3:12478826-12478848 GGCATGGGGGTGAATGCCTGTGG - Intergenic
955818911 3:62875301-62875323 GGCATCCGGCTGCGGGCTCGGGG - Exonic
964727255 3:159826264-159826286 GGCAGCCGGGTGAGTGAGTGGGG + Intronic
968319706 3:197754802-197754824 GGCATGGTGGTGCGTGCCCGTGG - Intronic
968917418 4:3502627-3502649 GGCCTCCAGCAGAGTGCCCGGGG + Intergenic
969449574 4:7265349-7265371 GGCATGCTGGTGTGTGCCTGTGG + Intronic
970412714 4:15825113-15825135 GGCATCAGGATGGGTGCCTGTGG - Intronic
975664966 4:76726453-76726475 GGCATGCGAATGAGTGCCTGTGG - Intronic
985725294 5:1512966-1512988 GGCATCCTGGTGTGGGCCTGCGG + Intronic
985834636 5:2261455-2261477 GGCATCTGTGTATGTGCCCGTGG + Intergenic
991454585 5:66788786-66788808 GCCAGCCTGGTGAGTGTCCGCGG + Exonic
992643999 5:78795321-78795343 GGCATCCAGCAGAGTGCCCTAGG - Intronic
994043381 5:95283842-95283864 AGCAGCCAGGTGAGTGCCGGTGG - Exonic
997164509 5:131645180-131645202 GGCATGGTGGTGTGTGCCCGTGG + Intronic
997577831 5:134996504-134996526 GGCATCCGGGTGAGTGCACTGGG + Exonic
1002091931 5:176810988-176811010 GGCTTCCGGGAGAGCGCGCGGGG - Intronic
1002908578 6:1470823-1470845 GCCATCAGGGTGAGTGCTCAGGG + Intergenic
1013529603 6:111006744-111006766 GGCATGCTGGTGAGTGCCTATGG - Intronic
1017733977 6:157343757-157343779 GGCATGATGGTGAGTGCCTGTGG + Intergenic
1018536766 6:164828578-164828600 GGCATGGTGGTGTGTGCCCGTGG - Intergenic
1019266051 7:117945-117967 GGGATCTGCGTGAGTGCCCCCGG - Intergenic
1019277343 7:182605-182627 GGGATCTGCGTGAGTGCCCCCGG - Intergenic
1026471007 7:70694254-70694276 GGCTGGCGGGTGAGCGCCCGGGG - Intronic
1031587466 7:123549636-123549658 GGCATGATGGTGAGTGCCTGTGG + Intronic
1032578563 7:133081843-133081865 GGCATCCGGGTGAGTGCCCGTGG - Exonic
1034895614 7:154874665-154874687 GACAGCTGGGAGAGTGCCCGTGG + Intronic
1035073621 7:156162607-156162629 GGCAGCCAGGTGAGTGGCCATGG - Intergenic
1039858414 8:41436172-41436194 GACAGCCGGCTGAGTGCCCATGG - Intergenic
1041839256 8:62249297-62249319 GGCGACCTGGCGAGTGCCCGCGG - Intronic
1047266430 8:123313879-123313901 GGCATGGTGGTGAGTGCCTGTGG + Intergenic
1049562073 8:143316925-143316947 GGCATCCAGGTGAGAGCCCCAGG - Intronic
1049750923 8:144283449-144283471 GGCATGGCGGTGCGTGCCCGTGG - Intronic
1051936248 9:22446726-22446748 GGAAGCCGGGGGAGGGCCCGGGG - Intergenic
1057504828 9:95625571-95625593 GGCATCCTGGTGAGTGTGCCAGG - Intergenic
1062134100 9:134915585-134915607 GGCTTCCGTGTGGGTGTCCGGGG - Intronic
1062318496 9:135979405-135979427 GGCAGTCGGGTGAGGGCCCTGGG - Intergenic
1062324040 9:136004042-136004064 GCCCTCAGGGTGAGGGCCCGAGG - Intergenic
1186093687 X:6077426-6077448 GGCATCCTGGTGTGTGCCTATGG - Intronic
1192137550 X:68618474-68618496 GGCATGGCGGTGAGTGCCTGTGG - Intergenic
1195699957 X:107697334-107697356 GGCATGCTGGTGTGTGCCTGTGG + Intergenic
1200102235 X:153693931-153693953 GGCATCAGCGTGACAGCCCGCGG - Exonic