ID: 1032578565

View in Genome Browser
Species Human (GRCh38)
Location 7:133081856-133081878
Sequence CACCGTGGTGAAGGGCATCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578565_1032578577 26 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578577 7:133081905-133081927 GGTGACCCGGCGGGTGCTGGTGG 0: 2
1: 0
2: 2
3: 25
4: 221
1032578565_1032578573 16 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578565_1032578571 13 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25
1032578565_1032578576 23 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578576 7:133081902-133081924 GAAGGTGACCCGGCGGGTGCTGG 0: 2
1: 0
2: 1
3: 10
4: 155
1032578565_1032578570 5 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34
1032578565_1032578574 17 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578565 Original CRISPR CACCGTGGTGAAGGGCATCC GGG (reversed) Exonic
900902096 1:5524030-5524052 AACGGTGGTGAAGGGCAGCTCGG - Intergenic
900902226 1:5524945-5524967 AACGGTGGTGAAGGGCAGCTCGG + Intergenic
903365408 1:22802701-22802723 CTCTGTGGGGAAGGGCATCAGGG - Intronic
905865836 1:41376234-41376256 CTCGTGGGTGAAGGGCATCCTGG + Intronic
906607571 1:47182617-47182639 CACAGAGGTGAGGGGCCTCCAGG + Intergenic
908095440 1:60732632-60732654 TACTGTGCTGAAGTGCATCCAGG - Intergenic
910221714 1:84894666-84894688 CACGGTGCTGAAGGGCAACCTGG + Intergenic
915318903 1:155045348-155045370 CACCGTGCTCAAGGGTAGCCAGG + Intronic
923233755 1:232012705-232012727 CAACGTGGTGATGTGCATTCTGG + Intronic
923415216 1:233749944-233749966 CACCGTGGTGAGGCCAATCCTGG + Intergenic
923490024 1:234476391-234476413 CACCCAGGTGAAGGGAATCCCGG + Intronic
1063478288 10:6347847-6347869 CACAGTGGGGCACGGCATCCAGG - Intergenic
1067567516 10:47349548-47349570 CACCGTGGAGAAGTCCATGCTGG - Exonic
1068963939 10:62893108-62893130 CACAGTGGTGGGAGGCATCCTGG - Intronic
1070993492 10:80754010-80754032 CATGTCGGTGAAGGGCATCCTGG + Intergenic
1073863979 10:107780439-107780461 CAGCCTGGTGAAGGGAATCTTGG + Intergenic
1076483727 10:130802066-130802088 CACCGTTGGGAATGGCAGCCAGG + Intergenic
1077517741 11:3012043-3012065 CAGGGTGTTGAACGGCATCCCGG - Intronic
1082806663 11:57456059-57456081 CACTGTGGTAAAAGGAATCCTGG - Intergenic
1083654050 11:64220513-64220535 CAGCGAGGTGCAGGCCATCCTGG + Exonic
1087002385 11:93434072-93434094 CAGCCTGGGGAAGGGGATCCGGG + Intronic
1089654336 11:119935902-119935924 CAGCGTGGTGAGCGGCACCCTGG - Intergenic
1091182986 11:133624024-133624046 CACAGTGGAGAGCGGCATCCAGG + Intergenic
1091697802 12:2639800-2639822 CACAGTGCTGAAGGGCAGCAAGG + Intronic
1096072438 12:48782777-48782799 CTACGTGGTGCTGGGCATCCTGG - Exonic
1096886385 12:54723172-54723194 GACCATAGTGAAGGGAATCCAGG + Intergenic
1105506963 13:21018577-21018599 CACCTGGGTGAAGGACATCAGGG - Intronic
1107636812 13:42400458-42400480 CACCATGGGGAAAAGCATCCAGG - Intergenic
1107987211 13:45785821-45785843 CACCTTGGGGAAGGGGAACCAGG - Intronic
1110779476 13:79448243-79448265 CAACGTGGAGAAGAGCATCTAGG - Intergenic
1117023619 14:51597560-51597582 CACCCTGTAGAAGGCCATCCTGG + Intronic
1117233281 14:53744255-53744277 AACTGTTGTAAAGGGCATCCTGG + Intergenic
1119223497 14:72927180-72927202 CACCATGGTGAAAGGCGTCATGG - Intronic
1121701483 14:95957874-95957896 CGCCTTTCTGAAGGGCATCCAGG + Intergenic
1122863595 14:104593611-104593633 CAGCGTGGTGATGGCCAGCCAGG + Exonic
1122918575 14:104870173-104870195 GGCCGTGGTGAGGGGCAGCCAGG + Intronic
1124478521 15:30058102-30058124 GACGGTGGTGCAGGGAATCCAGG + Intergenic
1124584665 15:30993476-30993498 CAGCGTAGTCAAGGGCATCAGGG - Intergenic
1126061763 15:44789720-44789742 CACTGTGGTAAAGGGCATGAAGG - Intergenic
1128092294 15:64927147-64927169 CACGCTGGTGAAGGGCCTGCTGG - Intronic
1128146122 15:65333383-65333405 TATCGGGGTGGAGGGCATCCAGG - Exonic
1130549297 15:84879612-84879634 CCCCGCGGTAAAGGGCATCTGGG - Intergenic
1130702162 15:86195270-86195292 TACCTTGGTGAAGGGCATGTTGG + Intronic
1132583229 16:694737-694759 CACCGAGGCGGAGGGCACCCTGG + Intronic
1132840879 16:1978039-1978061 CACCGTGCTGACTGTCATCCAGG + Exonic
1136029840 16:27494941-27494963 CACCATGGTGACTGGTATCCTGG - Intronic
1137557198 16:49478155-49478177 CACCCTGGTGAAGAGCATTGAGG - Intergenic
1141805413 16:86338367-86338389 CACCTGGGTGAGTGGCATCCAGG - Intergenic
1141916159 16:87098732-87098754 CACCTGGGAGAAAGGCATCCAGG + Intronic
1144892412 17:18501496-18501518 CGCCGTGGTGCAGGGGACCCTGG + Intergenic
1145139802 17:20442792-20442814 CGCCGTGGTGCAGGGGACCCTGG - Intergenic
1145796060 17:27655887-27655909 CGCCGTGGTGCAGGGGACCCTGG + Intergenic
1145810508 17:27761205-27761227 CGCCGTGGTGCAGGGGACCCTGG + Exonic
1145826994 17:27884550-27884572 GACCGTGAGGAAGGGCTTCCTGG - Intronic
1148127268 17:45243267-45243289 CACCCTGCGGAAGGGCAACCTGG + Exonic
1148150769 17:45395519-45395541 CACCATGGTCATGGGCATGCTGG + Exonic
1148466495 17:47868198-47868220 CACTTGGGTGAAGGGGATCCCGG - Intergenic
1148748320 17:49930771-49930793 CTGGATGGTGAAGGGCATCCTGG + Intergenic
1157381545 18:47222687-47222709 CACCCTGGTCAAAGGCATCTTGG - Intronic
1157452811 18:47800966-47800988 CACAGTGGAGGAGGGCATGCAGG - Intergenic
1162180170 19:8863301-8863323 CACCCTGCTGAGGGACATCCAGG - Exonic
1162444363 19:10713147-10713169 CATCGTGGAGAAGCGCTTCCCGG + Exonic
1163161857 19:15469629-15469651 CACCGCGGTGAAGTGCGGCCAGG + Exonic
1163757288 19:19113657-19113679 CACCCTGGTAAATGTCATCCTGG - Intergenic
1163758259 19:19119794-19119816 CACTGTGGTGAAGGGAACGCCGG + Exonic
1164580134 19:29429752-29429774 CACCGTCTTGGAGGGCATTCGGG + Intergenic
1164779392 19:30880396-30880418 CATCCTGAGGAAGGGCATCCAGG + Intergenic
1165012739 19:32860495-32860517 CACTGTCGGGAAGGGCATCATGG + Intronic
926723586 2:15980792-15980814 CTCCGGGGTGAAGGAGATCCAGG - Intergenic
927639931 2:24839952-24839974 CACCGTGCTGGGGGGCGTCCTGG - Exonic
935880728 2:107562428-107562450 CAGTGTGGTGAGGGGCATCCTGG + Intergenic
936666859 2:114607024-114607046 CACCATGGTGAAGGTTGTCCTGG + Intronic
944850947 2:203718309-203718331 TCACGTGTTGAAGGGCATCCTGG + Intronic
1171034910 20:21706676-21706698 CAACGTGGTCAAGCACATCCGGG + Exonic
1172929922 20:38579262-38579284 CCCCTTTGTGAAGGGCATCTTGG + Intergenic
1174060059 20:47826342-47826364 CACCGTGGTGACAGTCTTCCTGG + Intergenic
1174152215 20:48493635-48493657 CACCGTGGTGACAGTCTTCCTGG + Intergenic
1174338711 20:49882920-49882942 CACCATGGGGTAGGGCAGCCAGG - Intronic
1175772098 20:61630354-61630376 GACCGTGGTCAAGAGCATCCTGG - Intronic
1180252901 21:46601337-46601359 AAACGTAGTGAAGGGCTTCCTGG - Intronic
1180833325 22:18917396-18917418 CACAGTGGGGGTGGGCATCCCGG + Intronic
1181021198 22:20104127-20104149 CAGCTTGGTGCAGGGCATCCTGG + Intronic
1181066502 22:20308861-20308883 CACAGTGGGGGTGGGCATCCCGG - Intergenic
1183739005 22:39659825-39659847 CATCCTGGTGGAGGGCTTCCAGG + Exonic
1184287915 22:43482437-43482459 CAGAGAGGTGAAGGGCATCCTGG - Intronic
1185146553 22:49140110-49140132 CGCCCTGGGCAAGGGCATCCAGG - Intergenic
1185202694 22:49517706-49517728 GACCATGGTGAAGGCCAGCCTGG + Intronic
1203283411 22_KI270734v1_random:142700-142722 CACAGTGGGGGTGGGCATCCCGG + Intergenic
951706180 3:25546306-25546328 CACTGGGGTGAATAGCATCCAGG + Intronic
952526515 3:34216197-34216219 CACTGTGGTAAAGGGCATGAAGG + Intergenic
956297255 3:67728146-67728168 CGCCATGGTGGATGGCATCCAGG + Intergenic
956731435 3:72200239-72200261 CAAAGTGGGGAAGGGCTTCCAGG + Intergenic
959590512 3:108074726-108074748 CACAATGGAGAAGGGCATCCAGG + Intronic
962344517 3:134609657-134609679 CACAGTGGGGCAGGGCAGCCGGG - Intronic
968456906 4:704850-704872 CACCCTGGCGGAGGGCACCCAGG + Intergenic
968817819 4:2830855-2830877 CACCGTGGGCAAGGGCATTCGGG - Intronic
969173041 4:5379239-5379261 CAATGTGGGGAAGGGCAGCCAGG - Intronic
970934624 4:21554632-21554654 CACACTGGGGAAGGGCATGCAGG - Intronic
1002771326 6:292647-292669 CACCGCGGGAAAGGGCACCCCGG - Intronic
1009402434 6:63273310-63273332 GACTGTAGTGAAGGGCATTCTGG + Intergenic
1011554925 6:88564180-88564202 CACCTAGGAGAAGGGCATTCTGG - Intergenic
1011559883 6:88603547-88603569 CAAAGTGGGGAGGGGCATCCAGG - Intergenic
1016438230 6:144059293-144059315 CAGGGTGGTGCAGGGCATCAGGG + Intronic
1022652819 7:32292979-32293001 CACAGTTGTACAGGGCATCCTGG + Intronic
1024219334 7:47275748-47275770 AAACGTGGTCAAGGGCATCGGGG - Exonic
1024557588 7:50616774-50616796 CACCCAGGTGCAGGACATCCTGG + Intronic
1024762167 7:52611744-52611766 CAAAGTGTTGAAGGACATCCTGG - Intergenic
1028972825 7:96877470-96877492 CACAGTGTTGATGGGCATCAAGG + Intergenic
1032578565 7:133081856-133081878 CACCGTGGTGAAGGGCATCCGGG - Exonic
1034680087 7:152922052-152922074 CAACGTGGGGATGAGCATCCAGG + Intergenic
1038337851 8:26659902-26659924 CTCTGTGGTGAAAGGCATGCTGG + Intergenic
1038429655 8:27490161-27490183 CTCCGTGGTGGAGGGTATCTTGG + Intergenic
1042699923 8:71601096-71601118 AACCGAGGGGAAGGGCTTCCTGG - Intergenic
1045086624 8:98693626-98693648 CACAGTGGTGAATGGCATAGAGG - Intronic
1049214016 8:141399448-141399470 CACCGAGGGGAGGGGCAGCCGGG - Intronic
1052323404 9:27192569-27192591 GAGGGTGGGGAAGGGCATCCTGG + Exonic
1053069761 9:35094234-35094256 CACAGTGGACAATGGCATCCTGG - Exonic
1059445659 9:114336422-114336444 GACCATGGTGGATGGCATCCTGG + Exonic
1060996223 9:127876122-127876144 CAAGGTGGGGAAAGGCATCCAGG - Intronic
1061252031 9:129432113-129432135 CACCCTGAAGAAGAGCATCCAGG + Intergenic
1061421055 9:130472990-130473012 GACCGTGCAGGAGGGCATCCGGG + Intronic
1062001352 9:134217311-134217333 CTCCCAGGTGAGGGGCATCCTGG + Intergenic
1203773383 EBV:60392-60414 GAGCGTCGTGGAGGGCATCCAGG - Intergenic
1185466652 X:358900-358922 CACCGTGGGGACGGGCGCCCTGG + Intronic
1191642426 X:63441804-63441826 CACAGTGGTGAAGGCAATGCAGG - Intergenic
1196723965 X:118879168-118879190 CACCATGGTGCTGGGCATCATGG - Intergenic
1198564960 X:137894799-137894821 CCCCATGTTGAAGGGCAACCAGG - Intergenic