ID: 1032578566

View in Genome Browser
Species Human (GRCh38)
Location 7:133081857-133081879
Sequence TCACCGTGGTGAAGGGCATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578566_1032578570 4 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34
1032578566_1032578574 16 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48
1032578566_1032578576 22 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578576 7:133081902-133081924 GAAGGTGACCCGGCGGGTGCTGG 0: 2
1: 0
2: 1
3: 10
4: 155
1032578566_1032578577 25 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578577 7:133081905-133081927 GGTGACCCGGCGGGTGCTGGTGG 0: 2
1: 0
2: 2
3: 25
4: 221
1032578566_1032578573 15 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578566_1032578571 12 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578566 Original CRISPR TCACCGTGGTGAAGGGCATC CGG (reversed) Exonic
901413862 1:9103882-9103904 TCAACCTGGTGAATGGCAACTGG + Exonic
903365409 1:22802702-22802724 CCTCTGTGGGGAAGGGCATCAGG - Intronic
903982705 1:27201393-27201415 TTACCGTGGTGAAGGGCATCCGG - Intergenic
905824521 1:41018276-41018298 TCGGCCTGGTGAGGGGCATCAGG - Intronic
906074718 1:43043556-43043578 TCACAGTGGGGAAGGGCAAGTGG + Intergenic
906580804 1:46934045-46934067 ACATGGTGGTGTAGGGCATCTGG + Exonic
906598879 1:47106140-47106162 ACATCGTGGTGTAAGGCATCTGG - Exonic
906602920 1:47144849-47144871 ACATGGTGGTGTAGGGCATCTGG - Exonic
907122759 1:52022025-52022047 TCCACGTGGAGAAGGGCAGCTGG - Intronic
908175469 1:61551775-61551797 TCCCAGTGGTGATGGCCATCAGG - Intergenic
908817172 1:68046637-68046659 TCTCAGTGGTGTTGGGCATCTGG + Exonic
916746614 1:167689711-167689733 TCACAGTGTTGAAGGTCATGAGG + Intronic
919721353 1:200840063-200840085 GCACAGTGGTGAAGAGCATTTGG - Intronic
920865496 1:209748800-209748822 ACAGCGTGGTGTAGGGCAACAGG - Intergenic
1076287580 10:129315189-129315211 TCACCGTGTAGAGGGGCAGCAGG + Intergenic
1077551719 11:3203404-3203426 TCACCGTGCAGCAGGGCATGGGG + Intergenic
1087002384 11:93434071-93434093 TCAGCCTGGGGAAGGGGATCCGG + Intronic
1089919297 11:122193254-122193276 TCAAGGTGGTGAAGGTCATGTGG - Intergenic
1092918949 12:13213765-13213787 TCACCATGGAGAAGGGAAACCGG + Exonic
1105506964 13:21018578-21018600 GCACCTGGGTGAAGGACATCAGG - Intronic
1106840074 13:33677676-33677698 TCACCATGGTGAACTGCTTCAGG - Intergenic
1110961976 13:81638111-81638133 TCACCGTGGTAAATGGCCACAGG + Intergenic
1115767239 14:36635701-36635723 TCTCTGGGGTGAAGGTCATCAGG - Intergenic
1115770880 14:36663134-36663156 CCACCGTGGTGAAACACATCCGG + Exonic
1120698142 14:87667041-87667063 TCACCGGGGTGAAGTGAATGTGG + Intergenic
1123013768 14:105363537-105363559 TCACAGAGGTGAAGGGAGTCAGG + Intronic
1124584666 15:30993477-30993499 ACAGCGTAGTCAAGGGCATCAGG - Intergenic
1130549299 15:84879613-84879635 TCCCCGCGGTAAAGGGCATCTGG - Intergenic
1131842776 15:96455131-96455153 TCAACTTTGTGAAGGGCAACTGG - Intergenic
1135610013 16:23858319-23858341 TCACCAAGGTGAAGGGCTCCGGG + Intronic
1137353811 16:47738580-47738602 TTAACCTGATGAAGGGCATCTGG - Intergenic
1145816428 17:27798283-27798305 TCATCCTGGTGAAGGGCATCAGG - Intronic
1147536052 17:41323940-41323962 TCCCCATGGGGAAGGGCATGGGG + Intergenic
1151474922 17:74339885-74339907 TCACCGTGGAGAAGGTCACTGGG - Intronic
1153812128 18:8761501-8761523 TCACCAGGGTGAAGGGCAGGAGG - Intronic
1155235008 18:23810394-23810416 TCACTGAGCTGCAGGGCATCTGG - Exonic
1156274530 18:35570756-35570778 TCACTGTGATGATGGGAATCTGG + Intergenic
1157016815 18:43725019-43725041 GCAGCGTGATGAAGAGCATCAGG + Intergenic
1158828770 18:61254877-61254899 TCAGAGTGGAGAAGGGAATCAGG + Intergenic
1160802497 19:976857-976879 TCACCCTGGTTAAGGCCCTCTGG - Intergenic
1164826737 19:31289663-31289685 GAACCGTGCTGCAGGGCATCTGG - Intronic
929869509 2:45746385-45746407 TCACTGTTGAGAAGGGCACCTGG + Intronic
937594081 2:123652009-123652031 TCAGCATGGTGAGGGGCAGCAGG + Intergenic
1173975613 20:47184321-47184343 TTACGGTGGTGAAGGGCATGGGG - Intronic
1174118749 20:48246551-48246573 TGACCCTGGGGAAGGGCAGCAGG - Intergenic
1180924599 22:19544863-19544885 TCACCAGGGTGAAGGGAAACGGG + Intergenic
1181525902 22:23487012-23487034 TCACCGTGGTGATGGGATTAGGG - Intergenic
956214486 3:66834186-66834208 TCCACTTGGTGAAGGACATCTGG + Intergenic
959623511 3:108424187-108424209 TCCACGTGGTGAAGGCCAGCTGG + Intronic
966193217 3:177289913-177289935 ACACAGTGGTGAAGGGCAGGGGG - Intergenic
968817820 4:2830856-2830878 GCACCGTGGGCAAGGGCATTCGG - Intronic
973878896 4:55249037-55249059 TCACAGTGGTGAGAGGCGTCAGG - Intergenic
975393774 4:73852235-73852257 TAACAGTGGTGAAGGGTGTCAGG - Intergenic
986984231 5:13481904-13481926 TCACCATGGTCCAGGGCATTGGG + Intergenic
994316316 5:98338132-98338154 TCATCATGGTGTAGGGCATGAGG - Intergenic
996082538 5:119271595-119271617 TCACAGAGGGGAAGGGCATAGGG + Intronic
996212464 5:120828186-120828208 TAAATGTGGTCAAGGGCATCGGG + Intergenic
1007275382 6:40669498-40669520 TCACCCTTGTGAATGGCATTAGG + Intergenic
1010176776 6:73036740-73036762 TCCTCATGGTGAAGGACATCTGG + Intronic
1011706099 6:90003021-90003043 TCACCCTGGTGTAGGCCATCAGG + Intronic
1012552374 6:100475643-100475665 TCACCCTGTTGAAGAGCATTTGG + Intergenic
1016438229 6:144059292-144059314 CCAGGGTGGTGCAGGGCATCAGG + Intronic
1019852863 7:3576964-3576986 CCACCGTGGTGAAGTGCAAAAGG - Intronic
1024219335 7:47275749-47275771 TAAACGTGGTCAAGGGCATCGGG - Exonic
1027111272 7:75442141-75442163 TCACCGTGGGGAAGGCCTCCCGG + Intronic
1027283514 7:76626704-76626726 TCACCGTGGGGAAGGCCTCCCGG + Exonic
1032578566 7:133081857-133081879 TCACCGTGGTGAAGGGCATCCGG - Exonic
1038344802 8:26722643-26722665 TCCCCGTGGTGATGGGAATGTGG - Intergenic
1040450993 8:47547123-47547145 TCACCTTGATGGAGGGGATCAGG + Intronic
1042714303 8:71755801-71755823 TCAGCCTGATGAAGGGCAGCGGG + Intergenic
1058730433 9:107844923-107844945 TCACCTGAGGGAAGGGCATCTGG + Intergenic
1185641998 X:1593531-1593553 TCATCTTGGTGATGGGCTTCAGG - Exonic
1187202079 X:17144761-17144783 TCACCCTGGTAAATGGCAGCAGG - Intronic
1189695059 X:43655001-43655023 TGACCGTGGAGAAGGGCTGCGGG + Intronic
1191987479 X:66997866-66997888 TAAACGTGGTTAAGGGAATCAGG - Intergenic
1196815822 X:119664950-119664972 TCACCGTGGGGAGGCACATCTGG - Intronic
1197096781 X:122605215-122605237 TCACAGTGGTGATGGCCATGGGG + Intergenic
1198340102 X:135705562-135705584 TCACCTTAGTGAAGGGCTACAGG - Intergenic
1198343575 X:135738300-135738322 TCACCTTAGTGAAGGGCTACAGG - Intergenic