ID: 1032578567

View in Genome Browser
Species Human (GRCh38)
Location 7:133081864-133081886
Sequence GAGAACATCACCGTGGTGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578567_1032578577 18 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578577 7:133081905-133081927 GGTGACCCGGCGGGTGCTGGTGG 0: 2
1: 0
2: 2
3: 25
4: 221
1032578567_1032578574 9 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48
1032578567_1032578573 8 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578567_1032578576 15 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578576 7:133081902-133081924 GAAGGTGACCCGGCGGGTGCTGG 0: 2
1: 0
2: 1
3: 10
4: 155
1032578567_1032578571 5 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25
1032578567_1032578570 -3 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578567 Original CRISPR GAGAACATCACCGTGGTGAA GGG (reversed) Exonic