ID: 1032578567

View in Genome Browser
Species Human (GRCh38)
Location 7:133081864-133081886
Sequence GAGAACATCACCGTGGTGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578567_1032578577 18 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578577 7:133081905-133081927 GGTGACCCGGCGGGTGCTGGTGG 0: 2
1: 0
2: 2
3: 25
4: 221
1032578567_1032578574 9 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48
1032578567_1032578573 8 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578567_1032578576 15 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578576 7:133081902-133081924 GAAGGTGACCCGGCGGGTGCTGG 0: 2
1: 0
2: 1
3: 10
4: 155
1032578567_1032578570 -3 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34
1032578567_1032578571 5 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578567 Original CRISPR GAGAACATCACCGTGGTGAA GGG (reversed) Exonic
902163301 1:14549861-14549883 GAGAAAACCAGAGTGGTGAATGG - Intergenic
902878606 1:19356001-19356023 GGGAACAACATCGTGGAGAAGGG + Intronic
903982706 1:27201400-27201422 GAGAACATTACCGTGGTGAAGGG - Intergenic
908742418 1:67342433-67342455 GAGAACAACTCCGTGCTGATTGG + Intronic
909430542 1:75582769-75582791 TAGAAAATCACTGTAGTGAAAGG - Intronic
912384512 1:109264511-109264533 GAGAGCATCAACGTGGAGCAAGG + Exonic
915587895 1:156854231-156854253 GAGAACTGCAGCGTGGTGGAGGG - Exonic
917898653 1:179517966-179517988 GAGAAGATCATCCTGGTGGATGG - Intronic
919669923 1:200329314-200329336 GAGAACATCATCGTTGAGGAGGG + Intergenic
1065834015 10:29640762-29640784 GAGAACATCAATGGGGTGGAAGG - Intronic
1067013681 10:42738786-42738808 CAGAACAAGACCGTGTTGAAAGG + Intergenic
1073104313 10:101023565-101023587 GACAAGATCACGGAGGTGAATGG - Exonic
1073793205 10:106960731-106960753 GAGAACAGCAGCTTGGTGAGTGG - Intronic
1075838488 10:125476791-125476813 GAAAACATCACCAAGGGGAAGGG + Intergenic
1078072880 11:8129804-8129826 GAGAAAATCTCCATGGAGAAAGG - Intronic
1080053371 11:27880018-27880040 GAGGAAATTAACGTGGTGAATGG + Intergenic
1084289804 11:68155223-68155245 TAGAACTTCACCGTGTGGAATGG - Exonic
1086560852 11:88167438-88167460 GAGAACAACACCATGATGAGGGG + Intronic
1088742081 11:112775471-112775493 GAGAAGATCATGGTGATGAAGGG - Intergenic
1089989974 11:122850091-122850113 GAAACCATCACCGTGGAGGAAGG + Exonic
1091404102 12:198159-198181 GAGGAGATCACCGTGGAGACCGG - Intronic
1094175873 12:27540696-27540718 GAGAACATCACTGTGCTAACAGG - Intronic
1098621836 12:72610705-72610727 GAGAACATCACCATGGTGCAGGG + Intronic
1101672053 12:106884730-106884752 GAGAACAGCTCAGTGGTCAATGG - Intronic
1102524923 12:113505651-113505673 GAAAACATCACCTTGGGGAAGGG + Intergenic
1104387125 12:128360646-128360668 AATAACTTGACCGTGGTGAATGG + Intronic
1104439742 12:128785179-128785201 GATACCATCACCCTGGTGACTGG - Intergenic
1105318799 13:19296659-19296681 TAGAACATCAAAGTGATGAATGG - Intergenic
1113370403 13:109719768-109719790 GAGAAAATCACAGTGGGCAAGGG - Intergenic
1114805068 14:25825786-25825808 CAGGACAGCACAGTGGTGAAGGG - Intergenic
1117896936 14:60496836-60496858 CAGCACATCACCTTGGAGAAGGG - Intronic
1128157450 15:65400874-65400896 GAGAACACCACAGTGGTGTCTGG - Exonic
1132070011 15:98768130-98768152 GAGAACAGAACTGTGGAGAAAGG - Intronic
1136381534 16:29898293-29898315 GAGATCACCACTGAGGTGAAAGG - Intronic
1139241427 16:65396255-65396277 GAGAAAATCACCTGGGTGCAGGG + Intergenic
1140694047 16:77514179-77514201 AAGACCATCACCTTGGTGATTGG + Intergenic
1144296189 17:13877159-13877181 GAGAACATTACCAAGGTGCATGG - Intergenic
1144729180 17:17516906-17516928 GAGGAAATCACTCTGGTGAAGGG + Intronic
1147559791 17:41501692-41501714 GGGAACAGCCCCGTGGTGTAGGG - Intronic
1150151420 17:62811862-62811884 GAGGACTTCACCATGATGAATGG - Intergenic
1160326004 18:77948772-77948794 GAGATCATCACCGTGTTAAATGG + Intergenic
1161580212 19:5076800-5076822 GACAACATGACCCTGGGGAAAGG - Intronic
1162211774 19:9097569-9097591 GAGAAGATCATCATGGTTAAGGG - Intergenic
1165361114 19:35337632-35337654 GTGACCATCACCTGGGTGAAGGG + Intronic
1167750810 19:51379212-51379234 GAGAAGATCACGGTCATGAATGG + Intergenic
925631761 2:5901211-5901233 GTGAACACCACGGTGGTGTAAGG - Intergenic
925990685 2:9251727-9251749 GAGGACATCAGCGTGGCAAATGG + Intronic
926245509 2:11120146-11120168 AAGAACAACAAAGTGGTGAAAGG + Intergenic
930218983 2:48726463-48726485 AATAACATCACAGTGGTGTATGG - Intronic
931932804 2:67160136-67160158 GAGAACATCACAATGGCTAATGG - Intergenic
933318698 2:80745532-80745554 TAGAACATTACAGTGGTCAAAGG - Intergenic
935182235 2:100701426-100701448 GAAAACAGCAGCGAGGTGAATGG - Intergenic
941868637 2:170360701-170360723 GAGAGCCTCTCCGTGGTGAATGG + Intronic
942043638 2:172086665-172086687 GAGAAGAGCACGGTGGTGGAAGG + Exonic
945294833 2:208160371-208160393 GAGAACTTCCACGTGGAGAAGGG - Intergenic
945571065 2:211468473-211468495 GAGAACAGCACCGTGCTTATAGG + Intronic
946090411 2:217217614-217217636 GGGAACATCACAGTGGAGAGAGG + Intergenic
947631126 2:231653791-231653813 GAGAAAACCACTGTGGTGAAAGG - Intergenic
1168988235 20:2070126-2070148 GAGAACAGCACCAAGGCGAATGG + Intergenic
1172786287 20:37470871-37470893 GAGAACAGCACCGAGGGGGATGG - Intergenic
1179644154 21:42765480-42765502 GAGCACATGACCCTGGTGAGTGG + Exonic
1181067335 22:20313112-20313134 GAGAACAGCAGCCTCGTGAAGGG + Intergenic
1181562469 22:23713944-23713966 GAGAGCAGCACCGTGGGGAAGGG + Intergenic
950686242 3:14620502-14620524 GTCAACATCACGGTGATGAAAGG + Intergenic
954196994 3:49002790-49002812 GAGACCATCACCAAGGGGAACGG - Intronic
957131236 3:76224453-76224475 GAGAACATAATTGTGGAGAAAGG - Intronic
960338240 3:116444895-116444917 GACAACATCACCGTGAGGCAGGG - Exonic
960757963 3:121038844-121038866 CAGAACATTACCGGGGTTAAAGG - Intronic
962452302 3:135530488-135530510 GAGAAGAGCACAGGGGTGAAAGG - Intergenic
962615683 3:137124241-137124263 GAGACAATAAACGTGGTGAAGGG - Intergenic
965261045 3:166485757-166485779 TAGAATATCACTGTAGTGAAGGG + Intergenic
965673132 3:171167636-171167658 GAGAAAATCACTCTGGGGAAAGG + Intronic
971161937 4:24142326-24142348 GAGAAAAACAAGGTGGTGAAAGG + Intergenic
972423380 4:38910843-38910865 GAGGACATCAGAGTGGTGATAGG + Intronic
978607442 4:110496765-110496787 GAGAATACCACAGAGGTGAAGGG + Intronic
978822987 4:112987322-112987344 GAGAACATCACCAGGCTGCACGG - Intronic
984988537 4:185354673-185354695 GAAAGCATCACCTTGGTGAAAGG + Intronic
989308808 5:39988648-39988670 AAAAACATCACCCTGGAGAATGG + Intergenic
995435225 5:112128034-112128056 GAGCTCATCACCTTGGGGAAGGG - Intergenic
997061055 5:130503578-130503600 GAAAACATCACTGTGGAGCAGGG - Intergenic
1004769203 6:18762713-18762735 GAGAGCTTCAGAGTGGTGAAAGG - Intergenic
1004829431 6:19461713-19461735 GAGATCACCACCATGGTCAAAGG + Intergenic
1008478538 6:51959926-51959948 GACAACGTCACAGTGGAGAATGG - Exonic
1010882584 6:81198206-81198228 GAGAATATGACCCAGGTGAAGGG + Intergenic
1011839056 6:91473580-91473602 GAGAACATCAGCCTAGTTAAAGG + Intergenic
1013063858 6:106663603-106663625 GAGAACAGCACCAAGGGGAATGG + Intronic
1013174673 6:107667318-107667340 GAGAACATAAGCTTGGTTAATGG + Intergenic
1014865535 6:126524968-126524990 GAGAACATCAAAGGGGTCAAAGG + Intergenic
1020725489 7:11808266-11808288 GAGGACTTCTCCCTGGTGAATGG + Intronic
1023748339 7:43344376-43344398 GAGAACTTCAAAGTGCTGAAAGG - Intronic
1024347279 7:48325897-48325919 GAGAAAATCACTGAGGTGAGTGG + Intronic
1025227327 7:57177115-57177137 GAGAGCAGCACCGTGGGGAAAGG + Intergenic
1025230431 7:57200553-57200575 GAGAGCAGCACCATGGGGAAGGG + Intergenic
1025730543 7:64103163-64103185 GACAGCAGCACCGTGGGGAAGGG - Intronic
1026592268 7:71707218-71707240 GAGCACATAACTGTGGTGAATGG - Intronic
1032578567 7:133081864-133081886 GAGAACATCACCGTGGTGAAGGG - Exonic
1035189730 7:157155713-157155735 AAGAAAATCACCTTGGTAAATGG + Intronic
1038176125 8:25183876-25183898 GAGAGCATTCCCGTGGAGAAAGG - Intergenic
1038934955 8:32238960-32238982 GAGAAAAACACAGAGGTGAAGGG + Intronic
1039117618 8:34109993-34110015 GAGAACATCACGGTTGGGAATGG + Intergenic
1039994354 8:42518932-42518954 GGGAAAATCACCCTTGTGAATGG - Intronic
1042828208 8:72999314-72999336 GAGAACATCACCCTTGTATATGG + Intergenic
1052842716 9:33306795-33306817 GAGAAGAGCACCGTGGGGAAAGG - Intronic
1055427748 9:76213604-76213626 GTGAAGATCACCCTGGTCAAGGG - Intronic
1055907346 9:81309884-81309906 GAGAACTTCCCCTTGGTGGAAGG - Intergenic
1187046206 X:15649643-15649665 GAGATAATCAGTGTGGTGAATGG - Intronic
1198871348 X:141179606-141179628 GGGAAGATCACAGTGGTGAAAGG + Intergenic
1199785853 X:151104149-151104171 GAGAACATCAAGGTAGTGAGTGG - Intergenic
1200243176 X:154508288-154508310 CTGAACATCGCCCTGGTGAACGG - Exonic
1201437367 Y:13973805-13973827 GAGAACAGCACCCAGGGGAATGG + Intergenic