ID: 1032578568

View in Genome Browser
Species Human (GRCh38)
Location 7:133081865-133081887
Sequence TGAGAACATCACCGTGGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578568_1032578576 14 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578576 7:133081902-133081924 GAAGGTGACCCGGCGGGTGCTGG 0: 2
1: 0
2: 1
3: 10
4: 155
1032578568_1032578574 8 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48
1032578568_1032578571 4 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25
1032578568_1032578577 17 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578577 7:133081905-133081927 GGTGACCCGGCGGGTGCTGGTGG 0: 2
1: 0
2: 2
3: 25
4: 221
1032578568_1032578573 7 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578568_1032578570 -4 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578568 Original CRISPR TGAGAACATCACCGTGGTGA AGG (reversed) Exonic
900903185 1:5530933-5530955 TGAGAACAGCACCAAGGTGATGG - Intergenic
902129130 1:14243452-14243474 TTAGAACATAAACGTGGCGATGG + Intergenic
902878605 1:19356000-19356022 TGGGAACAACATCGTGGAGAAGG + Intronic
903982707 1:27201401-27201423 TGAGAACATTACCGTGGTGAAGG - Intergenic
907294644 1:53442502-53442524 TGAGACCAGCACCGAGGGGATGG - Intergenic
908076752 1:60528199-60528221 TGACACCATCCCCTTGGTGATGG + Intergenic
908076753 1:60528204-60528226 TGAGACCATCACCAAGGGGATGG - Intergenic
909829862 1:80174366-80174388 TGAGAACAGCACCAAGGAGATGG - Intergenic
910575125 1:88753732-88753754 TGAGAACAGCACCAAGGGGATGG + Intronic
912260834 1:108110567-108110589 TGAGAACAGCACCAAGGGGATGG + Intergenic
914904923 1:151736139-151736161 TGAGAACAGCACCAAGGGGATGG - Intergenic
917365882 1:174231821-174231843 TGAGAACAGCACCGAGGGGATGG + Intronic
918757810 1:188359207-188359229 TGAGAACAGCACCAAAGTGATGG + Intergenic
918767122 1:188500445-188500467 TGAGAACAGCACCAAGGGGATGG - Intergenic
921910607 1:220545216-220545238 GGAGAACATCACCCTGAAGAGGG + Intronic
921933922 1:220778481-220778503 TGAGAACAGCACCAAGGTGGTGG + Intronic
924792282 1:247262918-247262940 TGAGAATAGCACCGAGTTGATGG - Intergenic
1063515761 10:6693551-6693573 CGAGAACAACACCATGGGGATGG - Intergenic
1065002389 10:21348664-21348686 TGAAATCATTACTGTGGTGAGGG + Intergenic
1067565031 10:47330320-47330342 TGAGAAGATCACCATCCTGATGG - Intergenic
1068091059 10:52432707-52432729 TGGAAACATCACAGTGGGGATGG - Intergenic
1068200185 10:53774177-53774199 TGAGAACAGCACCAAGGAGATGG + Intergenic
1068867407 10:61909232-61909254 TGAGAACAGCACTATGGTGGGGG - Intronic
1069537482 10:69265648-69265670 TGAGGACAGCATCGTGGTGAAGG + Exonic
1069861628 10:71475295-71475317 TGTGAGCATCACAGTGGGGAGGG + Intronic
1070809547 10:79290735-79290757 TGAGAACGTCAGCCTTGTGATGG - Intronic
1071860639 10:89669181-89669203 TGACAACACCACCAAGGTGATGG + Intergenic
1072889756 10:99312934-99312956 TGAGAACAGCACCAAGGAGATGG - Intergenic
1073992423 10:109277459-109277481 AGAGAGCATTACCATGGTGAAGG - Intergenic
1075628611 10:123985232-123985254 TGAGAACAGCACCAAGGGGATGG + Intergenic
1075809695 10:125216041-125216063 TGAAGACATCACTGTGGTGTTGG + Intergenic
1075838487 10:125476790-125476812 TGAAAACATCACCAAGGGGAAGG + Intergenic
1076211732 10:128652472-128652494 TGATCAAATCACCGTGGGGAGGG + Intergenic
1077517269 11:3009569-3009591 TGAAAACAAAACCGTGGCGATGG + Intronic
1080079101 11:28193461-28193483 TGAGAACATCACTAGGGGGATGG + Intronic
1080319723 11:30992584-30992606 TCAGCAAATCACCATGGTGATGG - Intronic
1081093154 11:38898070-38898092 TGAGAACAGCACCAAGGGGATGG - Intergenic
1081584105 11:44372368-44372390 TGAGTACATCTCAGAGGTGAGGG - Intergenic
1085241788 11:75062562-75062584 TGAGAACAGCACCAAGGGGATGG - Intergenic
1086560851 11:88167437-88167459 GGAGAACAACACCATGATGAGGG + Intronic
1087171317 11:95052412-95052434 GGAGAACAACACCAGGGTGATGG - Intergenic
1088579343 11:111300053-111300075 TGGGAACATCACAGTGGGGTGGG + Intronic
1088742082 11:112775472-112775494 TGAGAAGATCATGGTGATGAAGG - Intergenic
1089325862 11:117656395-117656417 TGAGAACCTTCCCGTGGTGTAGG - Intronic
1090507130 11:127328153-127328175 TTAGAACATCACCAAGGTGATGG - Intergenic
1091727195 12:2854445-2854467 TGGGCACCTCACCATGGTGATGG + Intronic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1096974576 12:55692837-55692859 GAAAAACATCACCCTGGTGAGGG - Exonic
1098621835 12:72610704-72610726 TGAGAACATCACCATGGTGCAGG + Intronic
1099016377 12:77348464-77348486 TGAGAACAGCACCAAGGGGATGG + Intergenic
1102524922 12:113505650-113505672 TGAAAACATCACCTTGGGGAAGG + Intergenic
1104706762 12:130953418-130953440 TGAGAACATCCTCCTGGTGCTGG + Intergenic
1106619305 13:31358153-31358175 TGAGAACAACACCAAGGAGATGG - Intergenic
1107192715 13:37608696-37608718 TCAGAAAATCACCCTGCTGATGG + Intergenic
1107294605 13:38895924-38895946 TGAGTACCCCACAGTGGTGAGGG + Intergenic
1108247677 13:48533362-48533384 CGAGAACATAACCCTGGAGAAGG - Intergenic
1108263917 13:48685301-48685323 TGAGAACAGCACCGAGGGGACGG + Intronic
1110084087 13:71355361-71355383 CGAGAACAGCACCAAGGTGATGG + Intergenic
1110101581 13:71612978-71613000 TGAGACCATCAGCTTGCTGAGGG - Intronic
1110276995 13:73651948-73651970 TGAGAACAGCACCAAGGGGATGG + Intergenic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1112257988 13:97852340-97852362 TGAGAACAGCACTGGGGGGATGG + Intergenic
1114866617 14:26602155-26602177 TCAGAACATCCCCACGGTGACGG + Intergenic
1115205206 14:30896171-30896193 TGAAAACATTACCGTAGTGGTGG - Intronic
1119041164 14:71275930-71275952 TGAGAACAGCACAGAGGGGATGG - Intergenic
1120819395 14:88898019-88898041 TGAGAACAGCACCCAGGGGATGG + Intergenic
1120858698 14:89235200-89235222 TGAAAACATCACCATGGAGAGGG + Intronic
1121267187 14:92612032-92612054 AGAGAACAGCACCGAGGGGATGG + Intronic
1121466631 14:94119669-94119691 TGAGAACAACACCTTGCAGAAGG + Intergenic
1122056565 14:99102390-99102412 TGAGAACAGCACCAAGGAGATGG - Intergenic
1125993139 15:44129949-44129971 AGAGAACATCAGCTTGGGGAAGG + Intronic
1126320747 15:47420083-47420105 TGAGCACATCACCCTTCTGAAGG - Intronic
1126563002 15:50064921-50064943 TGAGAACAACACCGAGGGGATGG + Intronic
1126697676 15:51340106-51340128 TGAGAACAGCACTGAGGGGATGG + Intergenic
1127170430 15:56294966-56294988 TGAGAACATCACAGTAGTGAAGG + Intronic
1127715471 15:61645197-61645219 TGGTAACATCACAATGGTGAAGG - Intergenic
1127819489 15:62642497-62642519 TGAAAACATCACAGTGGACAAGG + Intronic
1131194137 15:90341662-90341684 TGAGAAATTCCCCATGGTGATGG + Intergenic
1132717452 16:1298949-1298971 TGAGCACGCCACCGTGGGGAGGG + Intergenic
1132939343 16:2499200-2499222 TGAGAAGAACACCTGGGTGAGGG + Intronic
1133707524 16:8369286-8369308 TGAGAACAGCACTGAGGGGATGG - Intergenic
1135151723 16:20012842-20012864 TGAGAACAGCACCAAGGGGATGG + Intergenic
1137300159 16:47142048-47142070 TGACAACCTTACCGTAGTGAGGG + Intronic
1137784598 16:51127871-51127893 TAAGAACATCAGAGTGGGGAAGG + Intergenic
1139799671 16:69512024-69512046 TGAGAACACAATGGTGGTGAGGG + Intergenic
1143458451 17:7083425-7083447 TGAGAACAGCACCAAGGAGATGG + Intergenic
1143988533 17:10936690-10936712 TGAGAGCATCAATGTGGTGTCGG + Intergenic
1144889964 17:18488969-18488991 GGAGAACGGCACCGTGGAGAAGG - Exonic
1145142252 17:20455348-20455370 GGAGAACGGCACCGTGGAGAAGG + Exonic
1145793659 17:27643553-27643575 GGAGAACGGCACCGTGGAGAAGG - Exonic
1151045524 17:70916085-70916107 TGAGAACAGCACCAAGGGGATGG - Intergenic
1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG + Intronic
1152914404 17:83025843-83025865 TGAGTACATCCCTGTCGTGACGG + Intronic
1153832911 18:8938928-8938950 TGAGAATAGCACCGAGGGGATGG - Intergenic
1154938403 18:21085765-21085787 TGAGAACATTGAGGTGGTGATGG - Intronic
1156172800 18:34506410-34506432 TGACATCATCACGGTGGGGATGG + Intronic
1159465928 18:68784369-68784391 TGAGAACAGCACCAAGGGGATGG + Intronic
1161573449 19:5042737-5042759 TGAGGACAGCACCGCGGGGATGG + Intronic
1162180171 19:8863310-8863332 AGAGTACATCACCCTGCTGAGGG - Exonic
1162488409 19:10976398-10976420 TGAGAACAACACCATGCTTATGG + Intronic
1165361113 19:35337631-35337653 TGTGACCATCACCTGGGTGAAGG + Intronic
925263945 2:2551416-2551438 TGAGTAGATGACGGTGGTGATGG + Intergenic
927225593 2:20762831-20762853 TGAAAATATTACCCTGGTGATGG - Intronic
928871697 2:35988374-35988396 TGAGAACAGCACCAAGGAGATGG + Intergenic
928925926 2:36579480-36579502 TGAGAACAGCACCAGGGGGATGG - Intronic
929091604 2:38222969-38222991 TGAGAACAGCACCAAGGAGATGG + Intergenic
929092840 2:38236660-38236682 TTAGAACATCAGAGAGGTGAAGG + Intergenic
929095958 2:38263503-38263525 TGAGAACAGCACCAAGGGGATGG + Intergenic
929546271 2:42856966-42856988 TGAGAATACCAACGTGCTGAGGG - Intergenic
929785553 2:44988343-44988365 TGAGAACACCACCAAGGAGATGG + Intergenic
930600061 2:53432513-53432535 TGAGAACAGCACCAAGGGGATGG - Intergenic
933484968 2:82909606-82909628 TGAGAACAGCACCCAGGTGATGG - Intergenic
933628732 2:84632446-84632468 TGAGAACATGTCTGTGGTCATGG - Intronic
936233280 2:110722902-110722924 TGAGAACAGCACCAAGGTGATGG - Intergenic
936666858 2:114607015-114607037 TGGAGACATCACCATGGTGAAGG + Intronic
937146133 2:119646507-119646529 TGAGAACAGCACCAAGGAGATGG + Intronic
942190618 2:173465338-173465360 TGGGAACATCACCATGCTGGTGG + Intergenic
945328668 2:208514502-208514524 TGAGAACAGCACTGAGGGGATGG + Intronic
945751783 2:213795694-213795716 TGAGAACAGCACTGAGGGGATGG - Intronic
946561746 2:220921821-220921843 TGAGAACAGCACCAAGGAGATGG + Intergenic
946636886 2:221739138-221739160 GGAGAACAGCACCGAGGGGATGG + Intergenic
947162419 2:227227770-227227792 TGAGATCATTACAGTGCTGATGG + Intronic
947705317 2:232270117-232270139 TGGGGACACCACCGTGGTGGAGG + Intronic
948658740 2:239493426-239493448 TGAGAACAGCACTGAGGGGATGG + Intergenic
1168969650 20:1922217-1922239 TGATGACCTCACCGTGGTGGGGG + Intronic
1172271493 20:33657943-33657965 TGGGAAGAACACAGTGGTGAGGG + Exonic
1173110659 20:40185104-40185126 TGAGAACAGCACCAAGGGGATGG + Intergenic
1174951360 20:55044745-55044767 TGAGGACAGCACCGAGGGGATGG - Intergenic
1175096969 20:56548883-56548905 TGAGAACAGCACCAAGGGGATGG - Intergenic
1176728727 21:10468134-10468156 TGCGAACATCACTGTAGTGAAGG + Intergenic
1177187557 21:17814715-17814737 TGAGAACAGCACTGAGGGGATGG + Intronic
1180153576 21:45965860-45965882 TGAGAACAGCACCAAGGGGATGG - Intergenic
1180241198 21:46507607-46507629 TAAGAAAATCACAGTGGTCATGG - Intronic
1181116244 22:20634133-20634155 TGAGAACATCTCCGTGTTCTGGG - Intergenic
1181562468 22:23713943-23713965 TGAGAGCAGCACCGTGGGGAAGG + Intergenic
1181616385 22:24057621-24057643 TAACAACATCAAAGTGGTGAAGG + Intronic
1182844957 22:33422813-33422835 TGAGAACGGCACCAAGGTGATGG + Intronic
1183678635 22:39313806-39313828 TGAGAACAGCCCTGTGGTCAGGG - Intronic
1183749966 22:39714295-39714317 TGGGATCATCACCGTGCTCATGG - Intergenic
1184915917 22:47568950-47568972 TGAGAACAGCACCGAGAGGATGG + Intergenic
1185396877 22:50596674-50596696 TTAGGACTTCACCATGGTGAAGG + Intronic
949703848 3:6792460-6792482 TGAGAACATCACCAAGTGGATGG - Intronic
949823631 3:8141376-8141398 TGAGAACAGCACCAAGGGGATGG - Intergenic
949951949 3:9236504-9236526 TGAGAACAGCACCAAAGTGATGG - Intronic
950111633 3:10422426-10422448 TGATCACATCACGGTGTTGACGG + Intronic
951191096 3:19772557-19772579 TGAGAACAGCACCAAGGGGATGG - Intergenic
951351783 3:21615174-21615196 TGAGCTCATTACCATGGTGAGGG - Intronic
951810026 3:26688665-26688687 TGAGAACAGCACCAAGGGGATGG + Intronic
952657839 3:35807774-35807796 TGAGACCATCATAGTGGGGAAGG - Intergenic
955551661 3:60091678-60091700 TGAGAACAGCACCAAGGGGATGG - Intronic
957694219 3:83613250-83613272 TGAGAACAGCACCAAGGGGATGG + Intergenic
960059965 3:113310741-113310763 TGAGAACAGCACTGAGGGGATGG - Intronic
960592530 3:119379534-119379556 TGAGATCCTAACCGTGGTGATGG - Intronic
961780668 3:129318432-129318454 TGAGGACATCACCGAGGGAATGG - Intergenic
963500439 3:146119125-146119147 TGAGAACATCACTAGGGTGATGG - Intronic
965833416 3:172824447-172824469 TGAGAACAGCACCAGGGGGATGG + Intergenic
966393677 3:179478832-179478854 TGAGAACATCACTAGGATGATGG - Intergenic
967506589 3:190259554-190259576 TGAGACCATCAATGTGGTTAGGG + Intergenic
967521079 3:190433847-190433869 TGAGAACAGCACCAAGGTTATGG - Intronic
969095125 4:4727041-4727063 TGAGAACAGCACCAAGGGGACGG - Intergenic
970547157 4:17141332-17141354 TTAGAACATCACTGTGTTCATGG + Intergenic
975636683 4:76457248-76457270 TGAGAACAGCACCAAGGTAATGG - Intronic
979253663 4:118590346-118590368 TGAGAACAGCACCAAGGGGATGG - Intergenic
980654607 4:135766027-135766049 TGACAACATCCACGTGGTGTTGG - Intergenic
981409919 4:144417776-144417798 TGAGAACAGCACCAAGGGGATGG + Intergenic
983168733 4:164511706-164511728 TGAGAACATCATTGTGGATATGG + Intergenic
983939534 4:173525463-173525485 TGCGAACATCACCCTGAGGATGG + Intronic
984182662 4:176503942-176503964 TGAGAATATCAGAGTGGTGATGG - Intergenic
984583417 4:181535669-181535691 TGAGAAGGTCAAAGTGGTGAGGG - Intergenic
986432078 5:7691288-7691310 TGAGAAACTCATCGTGCTGATGG - Intronic
987815016 5:22888526-22888548 TGAGCACCTCAACGTGCTGAGGG + Intergenic
990095503 5:52107357-52107379 TGACAACAGCACCATGGGGATGG + Intergenic
992448351 5:76853896-76853918 TGAGAACAGCACCAAGGGGATGG - Intronic
992940926 5:81760419-81760441 TCAGAAGATCACCTTGGGGAGGG - Intergenic
993735570 5:91472786-91472808 TGAGAACATCACTGTGAGGCAGG - Intergenic
993840048 5:92866473-92866495 TGAGAACATCATCATGGTGATGG - Intergenic
994156600 5:96510717-96510739 TGATAACAGCACTGTGGTAATGG + Intergenic
995362292 5:111311097-111311119 TGAGAGCATTACCTGGGTGAAGG + Intronic
995435226 5:112128035-112128057 TGAGCTCATCACCTTGGGGAAGG - Intergenic
995887452 5:116912045-116912067 TGAGAACATCCTTGTGGTGCTGG + Intergenic
995927315 5:117389863-117389885 TGAGAACAGCACCGAGGGGATGG - Intergenic
996888532 5:128389199-128389221 TAAGAACATGCCAGTGGTGATGG + Intronic
997061056 5:130503579-130503601 TGAAAACATCACTGTGGAGCAGG - Intergenic
998188268 5:139999807-139999829 TGAGAACATTTCAGTGCTGAGGG + Intronic
1000243439 5:159429527-159429549 TGAGAACAGCACCAAGGAGATGG + Intergenic
1003863940 6:10346715-10346737 TGAGAACAGCACTGGGGAGAAGG + Intergenic
1003986920 6:11444465-11444487 TGAGAACAGCACCAAGGGGATGG + Intergenic
1004176397 6:13343910-13343932 TGAGAACAGCATCGAGGGGATGG - Intergenic
1004180338 6:13375777-13375799 TGAGAAAATCCCCGTGCTAATGG - Intronic
1005042799 6:21614642-21614664 TGAGAATGTTACCCTGGTGAGGG - Intergenic
1005057040 6:21739249-21739271 TGGGAAAATCACCTTGGAGAAGG - Intergenic
1006377642 6:33680427-33680449 TGAGAACTTCACCCTGGACATGG + Exonic
1007278243 6:40691324-40691346 CGGGAGCAGCACCGTGGTGATGG - Intergenic
1009344075 6:62591747-62591769 ACAGAACAGCACCGTGCTGAAGG - Intergenic
1009542900 6:64986965-64986987 TTAGAACATCACCTTTCTGATGG + Intronic
1010009912 6:71037757-71037779 TGAGAACAGCACCAAGGGGATGG + Intergenic
1010536403 6:77036851-77036873 TGAGAACAGCACCAAGGGGATGG - Intergenic
1010882583 6:81198205-81198227 TGAGAATATGACCCAGGTGAAGG + Intergenic
1011172108 6:84516707-84516729 TGAGAACAGCACCAAGGGGATGG - Intergenic
1012464546 6:99502748-99502770 TGAGAACAGCACCAAAGTGATGG - Intronic
1014247862 6:119085943-119085965 TGAGAACAGCACCAAGGGGATGG + Intronic
1014415392 6:121177246-121177268 TGAGAACAGCACCAAGGGGATGG - Intronic
1016131208 6:140474207-140474229 TGATAACAGCACCAAGGTGATGG + Intergenic
1019334579 7:476935-476957 TGAGCCCAGCACCGTGGGGATGG - Intergenic
1021553453 7:21896386-21896408 TTAGAACATCAAAGTGCTGAAGG - Intronic
1022002120 7:26235936-26235958 TGAGAACAGCACTGGGGGGATGG - Intergenic
1022072259 7:26928106-26928128 TGAGAACACCAACTTTGTGAGGG - Intronic
1022221125 7:28314868-28314890 TGGGCACATCAGCGTGTTGAAGG + Intronic
1023731515 7:43196482-43196504 TGAGATCATCACAGAGGTGCTGG - Intronic
1024894098 7:54237153-54237175 TGAGAACAGCACTGAGGAGATGG - Intergenic
1025230430 7:57200552-57200574 TGAGAGCAGCACCATGGGGAAGG + Intergenic
1025730544 7:64103164-64103186 TGACAGCAGCACCGTGGGGAAGG - Intronic
1029917752 7:104229934-104229956 TGAGAACAGCACCAAGGAGAAGG + Intergenic
1030999454 7:116397971-116397993 TGAGAACAGCACCAAGGAGATGG - Intronic
1031806601 7:126315395-126315417 TGAGAGCATCAGCTAGGTGAAGG + Intergenic
1032578568 7:133081865-133081887 TGAGAACATCACCGTGGTGAAGG - Exonic
1034206667 7:149322129-149322151 TGAGGACAGCACCGAGGGGATGG + Intergenic
1034850362 7:154487687-154487709 TGTGAATATCATCGTGTTGAAGG - Intronic
1036914546 8:12792830-12792852 TGAGAAGAGCACCGAGGGGATGG + Intergenic
1037634565 8:20690156-20690178 TGAGAACAGAACCATCGTGATGG + Intergenic
1037941704 8:22956394-22956416 TGAGAACAGCACTGAGGTGATGG - Intronic
1038087761 8:24218647-24218669 TAAGTCCATCACAGTGGTGAGGG - Intergenic
1038294607 8:26279482-26279504 TGAGAACTTCGCTGTGGTGGAGG + Intergenic
1039757588 8:40540085-40540107 TGAACACATCAGCGTGATGAGGG + Intronic
1041270069 8:56103035-56103057 TGAGAACAGCACCGAGAGGATGG - Intergenic
1042528874 8:69794996-69795018 TGAGAACAGCACTGAGGGGATGG + Intronic
1043090198 8:75891750-75891772 TGAGAACAGCACTGAGGGGATGG + Intergenic
1043886145 8:85602990-85603012 TGAGAACAGCACCAAGGAGATGG + Intergenic
1046084107 8:109410540-109410562 TGAGAACAGCACCGATGGGATGG + Intronic
1047128896 8:121995849-121995871 TGAGAACAGCACCAAGGGGATGG + Intergenic
1047484962 8:125321034-125321056 TGAGAACAGCACCAGGGGGACGG + Intronic
1048922686 8:139245543-139245565 TGACAACAGCACCGAGGGGACGG + Intergenic
1052317943 9:27135838-27135860 TTAAAACATCACCATGATGAAGG + Intronic
1055561975 9:77530232-77530254 TGAGAACAGCACCAAGGTGAGGG - Intronic
1056008011 9:82294547-82294569 TGAGAACAACACTGAGGGGATGG + Intergenic
1057340003 9:94191906-94191928 TGAGAACAGCACCGAAGGGATGG + Intergenic
1057647594 9:96891505-96891527 AGGGAACATCACCTGGGTGATGG - Intergenic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1059034212 9:110735899-110735921 TGAGAACAGCACTGAGGGGATGG + Intronic
1059397864 9:114049792-114049814 TGAGCTCATCAACGAGGTGAAGG + Exonic
1203585518 Un_KI270746v1:65936-65958 TGCGAACACCACTGTAGTGAAGG - Intergenic
1185860546 X:3574733-3574755 TGAGGACATCCACGTGGTAAAGG + Intergenic
1190145690 X:47889869-47889891 TGAGAACAGCACCAAGGGGATGG + Intronic
1192912897 X:75624072-75624094 TGAGAACAGCACCAAGGTGATGG + Intergenic
1193547169 X:82844856-82844878 TGAGAACAGCACCAAGGAGATGG - Intergenic
1198171096 X:134105855-134105877 TGAGAACAGCATTGTGGGGATGG - Intergenic
1199188691 X:144945425-144945447 TGAATACACCACCGAGGTGATGG + Intergenic