ID: 1032578569

View in Genome Browser
Species Human (GRCh38)
Location 7:133081871-133081893
Sequence CGAGAATGAGAACATCACCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578569_1032578576 8 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578576 7:133081902-133081924 GAAGGTGACCCGGCGGGTGCTGG 0: 2
1: 0
2: 1
3: 10
4: 155
1032578569_1032578580 29 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578580 7:133081923-133081945 GGTGGTCCCACCCATGATTCCGG 0: 1
1: 0
2: 1
3: 6
4: 64
1032578569_1032578573 1 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578569_1032578577 11 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578577 7:133081905-133081927 GGTGACCCGGCGGGTGCTGGTGG 0: 2
1: 0
2: 2
3: 25
4: 221
1032578569_1032578570 -10 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578570 7:133081884-133081906 CTCATTCTCGTCCGCCTCGAAGG 0: 2
1: 0
2: 1
3: 3
4: 34
1032578569_1032578574 2 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578574 7:133081896-133081918 CGCCTCGAAGGTGACCCGGCGGG 0: 2
1: 0
2: 0
3: 4
4: 48
1032578569_1032578571 -2 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578571 7:133081892-133081914 CGTCCGCCTCGAAGGTGACCCGG 0: 2
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578569 Original CRISPR CGAGAATGAGAACATCACCG TGG (reversed) Exonic
903982708 1:27201407-27201429 CGAGAATGAGAACATTACCGTGG - Intergenic
904363336 1:29992863-29992885 TGAGAATGAGATCAGCACAGAGG - Intergenic
915129504 1:153687024-153687046 GGAGAATGAGAGCATCACCCTGG + Exonic
915655368 1:157354850-157354872 CCAGAATGATAACTTCACAGTGG + Intergenic
917365879 1:174231815-174231837 CTATCATGAGAACAGCACCGAGG + Intronic
1076263246 10:129088883-129088905 TGAGGATGAGACCATCACTGAGG - Intergenic
1077482386 11:2821882-2821904 ATAGAATGAGGACATCACTGGGG - Intronic
1078724044 11:13912573-13912595 CTATCATGAGAACAGCACCGAGG - Intergenic
1080325377 11:31065945-31065967 CCAGAATGAAAACTTGACCGGGG - Intronic
1080605935 11:33864852-33864874 CCAGAGTGAGACCAGCACCGAGG + Intronic
1083778294 11:64905444-64905466 TGAGAATGAGACTATCACCCGGG + Intronic
1098621834 12:72610698-72610720 TGAGAATGAGAACATCACCATGG + Intronic
1101524317 12:105514036-105514058 CAGGAAGGAGAACATCACCCAGG - Intergenic
1103794695 12:123495219-123495241 TGAGAATGACAACAGCACAGAGG + Intronic
1104495464 12:129232906-129232928 CTATCATGAGAACAGCACCGGGG + Intronic
1106404603 13:29462889-29462911 CTAGAACGAGGACATCATCGGGG - Intronic
1108263914 13:48685295-48685317 CTATCATGAGAACAGCACCGAGG + Intronic
1109867107 13:68279344-68279366 CTATAATGAGAACAGCACGGTGG + Intergenic
1110661437 13:78062695-78062717 GGAGAATGAGAACATGGCCTTGG - Intergenic
1110929410 13:81196038-81196060 CTATAATGAGAACATCATGGGGG + Intergenic
1112683128 13:101790098-101790120 CTAGAATTAGAACCTCACCTAGG - Intronic
1115686410 14:35801198-35801220 CGAGAAGGATAACATTACCATGG + Intronic
1121001458 14:90454519-90454541 CGAGCATTACATCATCACCGTGG + Intergenic
1126562999 15:50064915-50064937 CTATCATGAGAACAACACCGAGG + Intronic
1134522209 16:14924009-14924031 CGTGAACTACAACATCACCGTGG + Intronic
1134709879 16:16322660-16322682 CGTGAACTACAACATCACCGTGG + Intergenic
1134717094 16:16362679-16362701 CGTGAACTACAACATCACCGTGG + Intergenic
1134949724 16:18345985-18346007 CGTGAACTACAACATCACCGTGG - Intergenic
1134957657 16:18389480-18389502 CGTGAACTACAACATCACCGTGG - Intergenic
1138102501 16:54264997-54265019 CAAGAAGGAGAACATCAGCTGGG - Intronic
1141320336 16:83002560-83002582 CGAGAATGAACACATCACAATGG - Intronic
1141363840 16:83423960-83423982 CGTGAATAAGAACTTCACCTGGG + Intronic
1146667850 17:34716655-34716677 CGAGAATGAAAACACAACAGGGG + Intergenic
1149400331 17:56289467-56289489 CGTGAATGAGAACTTCACACTGG - Intronic
1151267095 17:72965068-72965090 CAGGAAGGGGAACATCACCGGGG + Intronic
1153387034 18:4510287-4510309 GGAGAATGAGAACCACACGGCGG - Intergenic
1160582089 18:79888580-79888602 CGGGAATGAGAACCGCACAGCGG - Intronic
1164830922 19:31320172-31320194 TGAGAATGACAACATGACCACGG + Intronic
925128109 2:1476224-1476246 CCAGAATCACAAGATCACCGGGG - Intronic
925213571 2:2072701-2072723 CTAGCATGAGAACAACACTGGGG - Intronic
927194807 2:20539909-20539931 AGAGAATGAGAAGACCACCAGGG - Intergenic
930081913 2:47457542-47457564 CTATAATGAGAACAGCACCCAGG + Intronic
932189319 2:69726154-69726176 CTATCATGAGAACATCACGGGGG - Intronic
936599198 2:113879089-113879111 TGAGAATGAGGACAACACAGTGG + Intergenic
938003842 2:127770978-127771000 CTAGAAGGAAAACATCACCATGG - Exonic
941094217 2:161217360-161217382 GGAGAATGAGATCATAACCATGG - Intronic
941345947 2:164369821-164369843 CGAGAAGGATAACACCACGGGGG - Intergenic
942987740 2:182162726-182162748 AGAGACTGAAAACATCACTGTGG + Intronic
945063229 2:205926221-205926243 CGGGAATGAGGACAACAGCGGGG + Intergenic
948180488 2:235975995-235976017 CAAGAATGAGAACATCTTCCTGG + Intronic
1176166987 20:63679525-63679547 CCAGCACGAGAACAGCACCGAGG - Intronic
1181562465 22:23713937-23713959 CTAGAGTGAGAGCAGCACCGTGG + Intergenic
1182797956 22:33004965-33004987 CTACAATGAGAACACCAACGTGG - Intronic
1183586718 22:38757034-38757056 CAAGAATGACAAAATCACCGAGG + Intronic
1184705904 22:46213267-46213289 TGAGAATGAGAACAACAATGTGG - Intronic
949823634 3:8141382-8141404 CGATCATGAGAACAGCACCAAGG - Intergenic
949921815 3:9008975-9008997 CGAGAATGAAACCAGCACAGAGG + Intronic
951692623 3:25412716-25412738 CGAGAAAAAGAACATGACCATGG + Intronic
958830133 3:99077201-99077223 TGAGAATGAGAACAGCACGGAGG + Intergenic
961635305 3:128329424-128329446 CCAGACTGAGAGCATCAGCGGGG - Intronic
961780670 3:129318438-129318460 CCATCATGAGGACATCACCGAGG - Intergenic
963018097 3:140844907-140844929 CTAGCATGAGAACATCATGGGGG + Intergenic
963500440 3:146119131-146119153 CTATAATGAGAACATCACTAGGG - Intronic
965460360 3:168954383-168954405 CTATAATGAGAACAGCACCAAGG - Intergenic
967014333 3:185468045-185468067 CTATCATGAGAACAGCACCGAGG + Intronic
971002354 4:22337472-22337494 CGAGAATGAGTTCATCACTTGGG - Intergenic
973989282 4:56387779-56387801 TGAGAATAAAAACATCACCTAGG + Intergenic
979920696 4:126492384-126492406 AGAGAATGAGAAAATCAGCCTGG + Intergenic
980659529 4:135839523-135839545 GGAGACTGAAAACATTACCGTGG + Intergenic
981100877 4:140828084-140828106 TGAGAATGAAAACAACACAGAGG - Intergenic
988941602 5:36152900-36152922 CGACAGTGAGAACATCCCCCAGG + Exonic
994992901 5:107019998-107020020 CTAGCATGAGAACATCACTCAGG + Intergenic
995927318 5:117389869-117389891 CTATTATGAGAACAGCACCGAGG - Intergenic
997347475 5:133202387-133202409 CCAGAATGGAAACATCACTGTGG + Intronic
1000288003 5:159844499-159844521 GGAGAGTGAGAACATCTCCCAGG - Intergenic
1006740724 6:36306586-36306608 AGAGAATGACATCATCACCACGG - Intronic
1009391058 6:63144721-63144743 CTATCATGAGAACATCACGGAGG - Intergenic
1013169854 6:107626919-107626941 AGAGGATGAGATGATCACCGAGG + Intronic
1017541236 6:155405185-155405207 AGACAATGGGAACATCGCCGGGG + Intronic
1018054021 6:160036183-160036205 CGTGAATGAGAAAATCAGTGTGG + Intronic
1026989172 7:74573577-74573599 CTGGAATGAGATCAGCACCGAGG + Intronic
1028749952 7:94372044-94372066 CGAGGGTGAGAACATTACCGTGG + Intergenic
1032578569 7:133081871-133081893 CGAGAATGAGAACATCACCGTGG - Exonic
1038843834 8:31210751-31210773 AGAGAATGAGAACTTGACCTTGG - Intergenic
1041235975 8:55802733-55802755 AGAGAATGAGAACGTAAACGGGG - Intronic
1051959594 9:22742510-22742532 TGAGAATGACAACACCACCTTGG + Intergenic
1052117130 9:24663006-24663028 CGGGAAGGGGAACATCACTGTGG - Intergenic
1052283894 9:26762748-26762770 CGAGAATGTGAGCAGCACAGTGG - Intergenic
1054425167 9:65058751-65058773 CGTGAATGCGAACATCACAAAGG - Intergenic
1057756532 9:97842935-97842957 CGAGAATGTGGAAATCACTGGGG - Intergenic
1186519730 X:10194840-10194862 CAAGAATGAGACCAACACGGCGG - Intronic
1188048928 X:25460661-25460683 CTATCATGAGAACATCACAGGGG + Intergenic
1189362829 X:40366560-40366582 CGAGAACGAGAACGGCACCAAGG + Intergenic
1193531178 X:82656453-82656475 GGAGAAAGTAAACATCACCGAGG - Intergenic
1199049571 X:143221294-143221316 CCAACATGAGAACAGCACCGAGG - Intergenic