ID: 1032578573

View in Genome Browser
Species Human (GRCh38)
Location 7:133081895-133081917
Sequence CCGCCTCGAAGGTGACCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032578569_1032578573 1 Left 1032578569 7:133081871-133081893 CCACGGTGATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 4
4: 88
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578566_1032578573 15 Left 1032578566 7:133081857-133081879 CCGGATGCCCTTCACCACGGTGA 0: 1
1: 1
2: 1
3: 4
4: 72
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578568_1032578573 7 Left 1032578568 7:133081865-133081887 CCTTCACCACGGTGATGTTCTCA 0: 1
1: 1
2: 3
3: 19
4: 223
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578567_1032578573 8 Left 1032578567 7:133081864-133081886 CCCTTCACCACGGTGATGTTCTC 0: 1
1: 1
2: 1
3: 11
4: 96
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578563_1032578573 29 Left 1032578563 7:133081843-133081865 CCACGGGCACTCACCCGGATGCC 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40
1032578565_1032578573 16 Left 1032578565 7:133081856-133081878 CCCGGATGCCCTTCACCACGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032578573 Original CRISPR CCGCCTCGAAGGTGACCCGG CGG Exonic
900308511 1:2022454-2022476 CCGCCACGAAGCTCACCTGGAGG - Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
901061175 1:6472608-6472630 CCCTCTAGAAGCTGACCCGGCGG - Exonic
902836809 1:19052825-19052847 ACGAATGGAAGGTGACCCGGTGG - Intergenic
903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG + Intergenic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
907012645 1:50977970-50977992 GCGCCTCCAAGGTTACCCGCGGG - Intergenic
1063944813 10:11165867-11165889 CCGCCTCCAACCTGTCCCGGCGG - Intronic
1080727556 11:34913667-34913689 CAGCCTGGAAGGTGACCGAGGGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1103167026 12:118778946-118778968 CGGCCTTGGAGGTGACCCAGAGG - Intergenic
1117545884 14:56794671-56794693 CCGCCCTGGAGGGGACCCGGCGG + Intergenic
1152001951 17:77652096-77652118 CCTCCTCGAAGGTCACTGGGTGG + Intergenic
1152365803 17:79855658-79855680 CAGCCTTGATGGTGACCCTGGGG + Intergenic
1153331584 18:3880014-3880036 CCGAGTCGCAGGTGACCCCGTGG + Exonic
1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG + Exonic
925419988 2:3703865-3703887 GCGCCTCGAAGGTGGCCGCGCGG - Exonic
934046042 2:88173180-88173202 CCCCCTCAAAGTTGACCCGTGGG - Exonic
934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
948642647 2:239385363-239385385 AGTCCTCGGAGGTGACCCGGAGG - Intronic
1174207033 20:48847782-48847804 CTGACTGGAAGGGGACCCGGGGG - Intergenic
1174743330 20:53038036-53038058 CCTCCCCGAAGGTGATCCTGCGG - Intronic
1177715920 21:24840006-24840028 CAGCATGGAAGGTGACCCGAGGG + Intergenic
1178907648 21:36649939-36649961 CCGCCTCCAAGGTTAGCCTGTGG - Intergenic
1180057499 21:45366559-45366581 CCGCCCCGCCGCTGACCCGGAGG - Intergenic
1183932643 22:41245151-41245173 CGGCCACGTAGGTGACCAGGTGG - Intergenic
1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG + Intronic
950091859 3:10301363-10301385 CTGACTCGCAGGTGACCCTGTGG - Exonic
961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG + Intergenic
962855873 3:139344176-139344198 CGGCCTCGGAGCTGAACCGGCGG - Exonic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
967847895 3:194058461-194058483 CCGCCGCGAGGCTGAGCCGGTGG + Intergenic
1003171271 6:3723633-3723655 CTGTCTCGAAGGGGACCAGGTGG + Exonic
1005806246 6:29476624-29476646 TCACCTGGAAGGTGACCCTGAGG - Intergenic
1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG + Intronic
1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG + Exonic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033283790 7:140023916-140023938 CCACCTGGCAGGTGACCTGGAGG - Exonic
1041166339 8:55096359-55096381 CCGCCTTGAAGGTGGCCTAGAGG - Intergenic
1048301804 8:133256765-133256787 CCGCCTCCAAGGTGAGGTGGGGG - Exonic
1190215420 X:48476621-48476643 CCGCCTGGAGGGGTACCCGGTGG + Intronic