ID: 1032590233

View in Genome Browser
Species Human (GRCh38)
Location 7:133185331-133185353
Sequence GACTCACCTTGGGTTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032590233_1032590239 26 Left 1032590233 7:133185331-133185353 CCTGACCCAACCCAAGGTGAGTC No data
Right 1032590239 7:133185380-133185402 GAAGTGAGAGTGCACAGATGTGG No data
1032590233_1032590240 27 Left 1032590233 7:133185331-133185353 CCTGACCCAACCCAAGGTGAGTC No data
Right 1032590240 7:133185381-133185403 AAGTGAGAGTGCACAGATGTGGG No data
1032590233_1032590241 28 Left 1032590233 7:133185331-133185353 CCTGACCCAACCCAAGGTGAGTC No data
Right 1032590241 7:133185382-133185404 AGTGAGAGTGCACAGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032590233 Original CRISPR GACTCACCTTGGGTTGGGTC AGG (reversed) Intergenic
No off target data available for this crispr