ID: 1032592603

View in Genome Browser
Species Human (GRCh38)
Location 7:133206026-133206048
Sequence CTTCTGTTTTAGAGGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032592600_1032592603 17 Left 1032592600 7:133205986-133206008 CCACAGAAAAGGGGAAAGCACAG No data
Right 1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032592603 Original CRISPR CTTCTGTTTTAGAGGAAAAG TGG Intergenic
No off target data available for this crispr