ID: 1032595633

View in Genome Browser
Species Human (GRCh38)
Location 7:133236783-133236805
Sequence TTGTGCCAGAGCAAGAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032595633_1032595636 12 Left 1032595633 7:133236783-133236805 CCTCTGTTCTTGCTCTGGCACAA No data
Right 1032595636 7:133236818-133236840 GTGTAGTGCAATCCCAGGGCTGG No data
1032595633_1032595639 29 Left 1032595633 7:133236783-133236805 CCTCTGTTCTTGCTCTGGCACAA No data
Right 1032595639 7:133236835-133236857 GGCTGGTTAATCCTCTTTAGTGG No data
1032595633_1032595634 7 Left 1032595633 7:133236783-133236805 CCTCTGTTCTTGCTCTGGCACAA No data
Right 1032595634 7:133236813-133236835 TCTCTGTGTAGTGCAATCCCAGG No data
1032595633_1032595640 30 Left 1032595633 7:133236783-133236805 CCTCTGTTCTTGCTCTGGCACAA No data
Right 1032595640 7:133236836-133236858 GCTGGTTAATCCTCTTTAGTGGG No data
1032595633_1032595635 8 Left 1032595633 7:133236783-133236805 CCTCTGTTCTTGCTCTGGCACAA No data
Right 1032595635 7:133236814-133236836 CTCTGTGTAGTGCAATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032595633 Original CRISPR TTGTGCCAGAGCAAGAACAG AGG (reversed) Intergenic
No off target data available for this crispr