ID: 1032597337

View in Genome Browser
Species Human (GRCh38)
Location 7:133254691-133254713
Sequence GGTAAACTATACTCTCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032597337 Original CRISPR GGTAAACTATACTCTCCTCA AGG (reversed) Intronic
901765785 1:11499230-11499252 TGTAAACTGTACTCCCCACAAGG + Intronic
903856521 1:26340930-26340952 TGTAAACTATCCCCTCCTCCTGG + Intronic
907613994 1:55905482-55905504 GGTAAATTATACCATCTTCAGGG - Intergenic
909970491 1:81980001-81980023 AGTAAAAGATACTCTCCACAGGG + Intronic
911361496 1:96882709-96882731 GATAATATATACTTTCCTCATGG + Intergenic
913182747 1:116337903-116337925 AGTATACTCTCCTCTCCTCAAGG + Intergenic
917904890 1:179578901-179578923 GTTATACTATACGCTCCTCAAGG - Intergenic
918467170 1:184832521-184832543 GGATAATTATACTCTCCTCGAGG - Intronic
1067907094 10:50304012-50304034 GGTAAAGCATACTCTCACCATGG - Intergenic
1070430021 10:76328376-76328398 TGTAAACTATATCATCCTCAGGG + Intronic
1070468121 10:76745674-76745696 GGAAAGCTATACTGTACTCATGG + Intergenic
1071286847 10:84156775-84156797 GGCAAAAAATACTCTCTTCATGG - Intergenic
1071880108 10:89888126-89888148 TGTAAACTAAATTCTTCTCATGG - Intergenic
1073613727 10:104971387-104971409 AGTAAAATACACTGTCCTCACGG + Intronic
1078319938 11:10325309-10325331 GGTAAACCATACCCTTCACAAGG + Intronic
1079192848 11:18295826-18295848 GGGAAGCTAGACTCTCCCCAAGG + Intronic
1080776098 11:35388151-35388173 GGTAAACCCTACTCCCCTAATGG - Intronic
1083869593 11:65478761-65478783 GGTGACCTTTGCTCTCCTCAGGG + Intergenic
1084324425 11:68391453-68391475 GGTCACCTTTGCTCTCCTCAGGG + Intronic
1088387006 11:109269993-109270015 GGTAGAGTATACACTGCTCAGGG - Intergenic
1090311549 11:125745784-125745806 GAGAAACTTTACTCTCCTCATGG + Intergenic
1092935979 12:13365104-13365126 GGCATACCATACTCTTCTCATGG + Intergenic
1096727157 12:53573738-53573760 GGTAAAGTATTTTCTCCTGAGGG - Intronic
1099744464 12:86684995-86685017 AGCAAAATATACTATCCTCAGGG - Intronic
1107673188 13:42768031-42768053 AGGAAAGTATACTCTTCTCATGG - Intergenic
1111787954 13:92815274-92815296 GCTAAAATATCCTCTCTTCATGG - Intronic
1111942564 13:94626749-94626771 GCTAAACCATTCTCTCCTAAGGG - Intronic
1113258093 13:108529319-108529341 GGAAGAGTATACTCTCCTCAAGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1125166346 15:36710388-36710410 GGTAAACTATTCTCTATTCTTGG - Intronic
1125349691 15:38753967-38753989 GTTAAACCATACTTTCCTCAGGG + Intergenic
1129178326 15:73855925-73855947 GGTACACTATCCTGTACTCATGG + Intergenic
1132574256 16:657373-657395 GCTAAACCACAGTCTCCTCAGGG - Intronic
1133309175 16:4831869-4831891 GCTTATCTATACTCTGCTCATGG - Intronic
1136449871 16:30347813-30347835 GGGTAACTAGACACTCCTCATGG + Intergenic
1138790235 16:59895345-59895367 GGTAAAATAGATTTTCCTCAAGG + Intergenic
1138810601 16:60145508-60145530 GGTAGACTTAACTCTTCTCAAGG - Intergenic
1140623909 16:76769620-76769642 GGTAAACAATACACTCCTTTAGG + Intergenic
1141024512 16:80532636-80532658 GGAAATCTATATTCTCCTCTTGG + Intergenic
1143454156 17:7054954-7054976 GAATAAATATACTCTCCTCAAGG - Intergenic
1150092054 17:62335364-62335386 GCTTTATTATACTCTCCTCAGGG - Intergenic
1150256770 17:63752671-63752693 AGGAAACAATACTCTCCTTAAGG + Intronic
1157571118 18:48713044-48713066 GATAAACTGTACTCTGGTCAAGG - Intronic
925272578 2:2623426-2623448 AGTTGACTATACTATCCTCAAGG + Intergenic
925558344 2:5157689-5157711 GGTAAAATATATTTTCTTCAGGG + Intergenic
927046011 2:19279230-19279252 GGAAAAATATTCTGTCCTCATGG - Intergenic
929327902 2:40640031-40640053 GCTGGACTATACACTCCTCAAGG - Intergenic
931928804 2:67105777-67105799 GGTCCACAAGACTCTCCTCATGG + Intergenic
938795489 2:134715587-134715609 GGAAAACTTTGCACTCCTCAAGG + Intronic
943083851 2:183288498-183288520 GAGAAACTAGACTCTCTTCAAGG + Intergenic
945309503 2:208294791-208294813 GGTAAAATAGTTTCTCCTCAGGG + Intronic
947134254 2:226961249-226961271 GGTATATTATACCCTCCTCGTGG + Intronic
948336488 2:237211417-237211439 GATACAATATACTCTACTCATGG + Intergenic
1169523585 20:6399494-6399516 GCTAGACTGTACACTCCTCAGGG - Intergenic
1170746260 20:19101612-19101634 GTTAGACTATACACTCCTCAAGG + Intergenic
1172266077 20:33615491-33615513 GATAAATTGTACTTTCCTCAGGG - Intronic
1181802393 22:25356084-25356106 GGTCACCTTTGCTCTCCTCAGGG - Intronic
1184947958 22:47817804-47817826 GGTGAGATGTACTCTCCTCATGG - Intergenic
951115449 3:18855887-18855909 GGTAAACTCTAAGCTCCTCAAGG - Intergenic
951917257 3:27815194-27815216 GGTAAATTATAATTTACTCAAGG + Intergenic
951974382 3:28487955-28487977 GGTAAAATAGTTTCTCCTCAGGG + Intronic
952156019 3:30644372-30644394 GCTAAACTATAATTTCCTTAAGG + Intronic
952908373 3:38159678-38159700 GGTCAACTGTACTCACCACATGG + Intergenic
960449893 3:117793708-117793730 TATAAACTATACTGTCCTAATGG + Intergenic
962552195 3:136506031-136506053 GTTAACCTATCCTCTCCTTAAGG + Intronic
964372659 3:156017201-156017223 GGTAAAATATACTATCATCCCGG + Intergenic
966588667 3:181654892-181654914 TGTAAACTATACATTCCTCAAGG - Intergenic
967274251 3:187758156-187758178 GCTAAACTATAAGCTTCTCAAGG + Intergenic
968029443 3:195470792-195470814 GGTAAAATATGCTCTACACAAGG - Intergenic
969103336 4:4786356-4786378 GTTAAACTCTACTCTCCTTAAGG + Intergenic
971149350 4:24014709-24014731 GGTGACAGATACTCTCCTCATGG - Intergenic
971269364 4:25126009-25126031 GGAAAAATTTACTCTCCTGAAGG - Intronic
972993900 4:44855513-44855535 TATATACTGTACTCTCCTCAGGG + Intergenic
973082115 4:46006434-46006456 GGTAAACTTTACTGGCCACAGGG + Intergenic
978785497 4:112605120-112605142 GGTAATGTATACTCCCCACAAGG + Intronic
979706860 4:123730627-123730649 GGAAAACTATTCTATGCTCATGG - Intergenic
979776160 4:124590669-124590691 TGCATGCTATACTCTCCTCAAGG + Intergenic
979856710 4:125641854-125641876 ATTAAACCTTACTCTCCTCAAGG - Intergenic
986066908 5:4243297-4243319 GGAAAGCTATAGTCTCCGCACGG - Intergenic
987213148 5:15705350-15705372 GGTAATCCATACTCTCCTGAGGG + Intronic
989360054 5:40591624-40591646 GGAAAAATATTCTCTTCTCATGG - Intergenic
993947352 5:94131710-94131732 GGGAAACTTTAATATCCTCATGG + Intergenic
995620399 5:114020020-114020042 GGTATGGTATAATCTCCTCATGG + Intergenic
1000841721 5:166227991-166228013 CATAAACTTTACTCTCCACAAGG - Intergenic
1003555784 6:7138848-7138870 GGTAAACTATACTCTTATTACGG - Intronic
1012434419 6:99200015-99200037 GGAAAAACATACTATCCTCATGG - Intergenic
1014192223 6:118509948-118509970 ATTAGACTATACTCTCCTTATGG + Intronic
1014286989 6:119511112-119511134 GGTAAACTAGACCCTCCATAGGG + Intergenic
1015933819 6:138388479-138388501 GGTAAAATAAATTCTCCTGAGGG - Intergenic
1016249173 6:142020110-142020132 GGAAATCTATCCTATCCTCAAGG + Intergenic
1017337499 6:153279554-153279576 GGGAAACTATAAGCTCCTCTTGG + Intergenic
1018153415 6:160962272-160962294 GGGATACAATACTCTCCACATGG + Intergenic
1023533691 7:41185756-41185778 GTTAAAGAATTCTCTCCTCAGGG - Intergenic
1029660944 7:101961145-101961167 GGTGAATGCTACTCTCCTCATGG - Intronic
1032597337 7:133254691-133254713 GGTAAACTATACTCTCCTCAAGG - Intronic
1033336151 7:140454333-140454355 GGAAAACAACACACTCCTCAGGG + Exonic
1038229441 8:25686598-25686620 GGCCAACTCTACTCTCATCACGG - Intergenic
1041339389 8:56826358-56826380 GGTAAACTGTTCTCTCCTAAGGG - Intergenic
1041352186 8:56958372-56958394 AGTAAACTCTTCTCTCCCCATGG - Exonic
1042994360 8:74679193-74679215 GGTACAGTATACACTGCTCAGGG - Intronic
1043921485 8:85988619-85988641 GGGAAACTCTCCTCTCTTCAAGG + Intronic
1046101837 8:109623254-109623276 GGTAAACATTACCCTCCTCAAGG + Intronic
1046535309 8:115501317-115501339 GGTAGACAATTCTGTCCTCAAGG + Intronic
1051951243 9:22636231-22636253 GGTAAACTAGACCCTCCCTATGG + Intergenic
1055524028 9:77111737-77111759 GCTAAATAACACTCTCCTCAGGG - Intergenic
1057517679 9:95735884-95735906 AGTAAACTATAAACTCCTCTTGG + Intergenic
1057789705 9:98116446-98116468 GGTGAATTATTCTCTTCTCAAGG - Intronic
1061329573 9:129884075-129884097 GGTAAACGATTCTCTTCCCAGGG + Intergenic
1188951035 X:36375475-36375497 AGTAGAATATACTCTTCTCAAGG - Intronic
1196427073 X:115581220-115581242 GGTAAACCATACTTTCCTTAAGG - Intronic
1196890009 X:120282621-120282643 GCTAAACTATGCACTCCCCAAGG - Intronic
1201271444 Y:12259396-12259418 GGTACAGTATACACTGCTCAGGG + Intergenic
1201578809 Y:15490038-15490060 GGTAGACTTTACCCTGCTCAGGG + Intergenic