ID: 1032605491

View in Genome Browser
Species Human (GRCh38)
Location 7:133346319-133346341
Sequence ATGGAGAAGCAGACAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 580}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032605491_1032605492 -9 Left 1032605491 7:133346319-133346341 CCTGCTTCTGTCTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 66
4: 580
Right 1032605492 7:133346333-133346355 CTTCTCCATCCAGCGCTCATTGG 0: 1
1: 0
2: 0
3: 12
4: 130
1032605491_1032605495 4 Left 1032605491 7:133346319-133346341 CCTGCTTCTGTCTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 66
4: 580
Right 1032605495 7:133346346-133346368 CGCTCATTGGAACTGTACTCCGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032605491 Original CRISPR ATGGAGAAGCAGACAGAAGC AGG (reversed) Intronic
900001767 1:18385-18407 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900021487 1:188908-188930 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
902073693 1:13765337-13765359 ATAGAGAGGAAGAGAGAAGCTGG - Intronic
902083034 1:13834220-13834242 ATTGAGAAGCAATCAAAAGCTGG - Intergenic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
903018272 1:20375899-20375921 AGTGACAGGCAGACAGAAGCAGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903143346 1:21353706-21353728 CTGAAGAATCATACAGAAGCTGG + Intergenic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
904420863 1:30390339-30390361 AAGGGGAAGCAGAGAGAAACTGG + Intergenic
905107397 1:35572705-35572727 AGGGAGTTGGAGACAGAAGCTGG - Intergenic
906535058 1:46546907-46546929 TTTGATAGGCAGACAGAAGCAGG + Intronic
906663536 1:47599859-47599881 ATAAAGAAGCAAAGAGAAGCAGG + Intergenic
907270880 1:53290378-53290400 AGGGAGAAGAAGACAAAAGGCGG + Intronic
907276963 1:53322016-53322038 CTGGCTAAGCAGACAGGAGCAGG + Intronic
907645079 1:56234329-56234351 ATGGAGACGAAGACACAGGCTGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909102524 1:71367327-71367349 ATGGAGAAAATGACAGCAGCAGG - Intergenic
909962767 1:81867932-81867954 TTGGAGAATCTGACAAAAGCTGG + Intronic
910226727 1:84943478-84943500 GAGGAGAAGCAAACAGAACCAGG + Intronic
910366612 1:86472106-86472128 ATGGAGAAATAGGCAGCAGCTGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912968339 1:114257036-114257058 TTGGAGGAGCATACAGAGGCAGG - Intergenic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
913685347 1:121226559-121226581 ACGGAGAAGCTGACAACAGCTGG - Intronic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914037193 1:144014163-144014185 ACGGAGAAGCTGACAACAGCTGG - Intergenic
914152262 1:145053769-145053791 ACGGAGAAGCTGACAACAGCTGG + Intronic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
914676049 1:149908362-149908384 AGGGAGGAGCAGGGAGAAGCTGG - Intronic
915039232 1:152953924-152953946 ATGGTGGAGCACACTGAAGCTGG - Intergenic
915271900 1:154759395-154759417 ATGGAAAAGCTGACAGAATATGG + Intronic
915448525 1:155988986-155989008 TTGGAGAAAGAGACAGAGGCAGG + Intronic
915606728 1:156956706-156956728 ATGGGACAGCAGGCAGAAGCTGG + Intronic
916523017 1:165581930-165581952 GTGCAGAAGCAGACCGGAGCCGG + Intergenic
916589612 1:166177510-166177532 ATCCAGGAGCAGCCAGAAGCAGG - Intergenic
917645308 1:177023722-177023744 AGGGATCAGCAGACAGAGGCTGG + Intronic
918786496 1:188769989-188770011 ATGGAGAAATTGACAGAAGCAGG + Intergenic
918975962 1:191486771-191486793 ATGGAGAAACAGACAGGTGGTGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919303409 1:195799359-195799381 AAGGAGAAGCACAAAGCAGCAGG - Intergenic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
919869888 1:201812365-201812387 AGTGAGAAGCAGGCAGAAGGAGG + Intronic
921550353 1:216527807-216527829 ATGAAGATGAAGACATAAGCAGG + Intronic
922018366 1:221676158-221676180 ATGCAGCAGCAGATAGGAGCAGG + Intergenic
922047384 1:221959581-221959603 ATAGACACACAGACAGAAGCAGG + Intergenic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
923029203 1:230233918-230233940 ATGGAAATGCAGACAATAGCCGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
924674405 1:246160932-246160954 GAGCAGCAGCAGACAGAAGCTGG + Intronic
924814850 1:247432607-247432629 CTGGAGAGGCAGACACAAACAGG + Intronic
1062911106 10:1212933-1212955 ACGCAGAAGCAGACAGTACCTGG + Intronic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063228111 10:4034920-4034942 CTGGAGAAGCAGACAGCACCTGG - Intergenic
1063925067 10:10969565-10969587 AGGGAGAAGGAGATAGAAACAGG - Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1066239773 10:33522328-33522350 ATTGGGAAGGAGACAGAACCAGG + Intergenic
1067183801 10:44010200-44010222 AATGAGAAGCAGACCCAAGCAGG - Intergenic
1068281399 10:54875332-54875354 ATGGGGAAGAAGAGAGAAGGAGG - Intronic
1069210085 10:65746197-65746219 ATGGAGAATGAGACAGACACAGG - Intergenic
1069785552 10:70985814-70985836 AGAGAGAAGCAGACACAAGGTGG - Intergenic
1069842410 10:71348062-71348084 ATCAAGAAGCAGACAGCCGCTGG + Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1071071418 10:81698057-81698079 ATGGACAAACTGACAGAAGTAGG + Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1072783725 10:98266985-98267007 AAGGAGAAGGGGACAGAAGAGGG + Intronic
1073062949 10:100743092-100743114 ATGGGGAAGCGGCCAGGAGCCGG + Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1073941688 10:108706530-108706552 ATTGGGAAGCAGGCAGAAGATGG - Intergenic
1075136115 10:119787757-119787779 ATCTAGAAGCAGACAGTAGCAGG + Intronic
1075465393 10:122646980-122647002 ATGCAGAAGCAGCAGGAAGCTGG + Intergenic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076365371 10:129918299-129918321 ATGGAGAATGAGACAGAAGTGGG - Intronic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1077721860 11:4637853-4637875 ATGAAGAAGGAAACTGAAGCTGG + Intergenic
1077793055 11:5461849-5461871 ATGCTGAAACAGGCAGAAGCTGG - Intronic
1078891476 11:15561824-15561846 ATGCAGAAGCTGACTCAAGCGGG - Intergenic
1079130764 11:17745645-17745667 AGAGAGAAGCAGACAGCAGAGGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079481956 11:20890510-20890532 ATGGACAAATTGACAGAAGCAGG + Intronic
1081574956 11:44313305-44313327 ATGGAGGTGGAGAAAGAAGCGGG - Intergenic
1081929495 11:46858880-46858902 GAGGACAAGCACACAGAAGCGGG + Exonic
1082892765 11:58157818-58157840 CTGGAGAAGCAGACGTGAGCAGG + Intronic
1082994074 11:59234736-59234758 ATGGATGAACTGACAGAAGCAGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1084067676 11:66714728-66714750 AAGGTGAAGCCGACAGAACCCGG + Intronic
1084521879 11:69668312-69668334 ATGCAGAAACAGACAGAACTGGG + Intronic
1084710615 11:70841655-70841677 AGGGAGAAGCAGACGGAAAGGGG - Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085532222 11:77198636-77198658 ATGGAGATGCAGACAGACAGAGG + Intronic
1085769665 11:79313612-79313634 AGCATGAAGCAGACAGAAGCAGG - Intronic
1085791561 11:79501400-79501422 AGAGATAAGCAAACAGAAGCAGG - Intergenic
1086423832 11:86664702-86664724 GTGGAGATGCTGACAGATGCTGG + Intronic
1087105108 11:94400814-94400836 AGGGAGACGAAGACAGAAGGTGG + Intronic
1088260011 11:107935025-107935047 ATGGAGAGGCAGGCAAAGGCCGG - Intronic
1088435869 11:109812616-109812638 ATGCAGTAGCGGACAGGAGCAGG + Intergenic
1088568033 11:111194333-111194355 ATGGTGAAGCACCCAGCAGCTGG + Intergenic
1088691895 11:112335514-112335536 AGAGAGAAGCAGACAGGAGTGGG - Intergenic
1088894180 11:114065293-114065315 ATAGAGAAGGAAACGGAAGCCGG - Intronic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091195434 11:133726895-133726917 AGGGACCAGCAGAAAGAAGCAGG - Intergenic
1091333212 11:134747081-134747103 ATGGCGAAGCAGGCAGGAGCTGG - Intergenic
1091374845 12:18490-18512 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091471378 12:731058-731080 ATGCAGAAGTAGAGAGCAGCTGG + Intergenic
1092566628 12:9673054-9673076 ATGGATAAACTGACAGAAGTAGG - Intronic
1092586084 12:9902820-9902842 ATGGGGAATGATACAGAAGCAGG - Intronic
1092587124 12:9911069-9911091 ATGGGGAACTACACAGAAGCAGG - Intronic
1093303432 12:17480270-17480292 ATGGATAAATTGACAGAAGCAGG + Intergenic
1093704351 12:22258060-22258082 AGTGAGAAGTAGCCAGAAGCTGG + Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095721328 12:45404659-45404681 AGGGGGAAGAAGACAGAAGGCGG - Intronic
1096534673 12:52263739-52263761 ATGGGGAGGCAGACAGACCCAGG + Intronic
1097177366 12:57151204-57151226 ATGGAGAAGTTGAGAAAAGCTGG + Intronic
1097523528 12:60700455-60700477 GTGAAGAAGGAGGCAGAAGCTGG - Intergenic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1097813652 12:64046651-64046673 GGGGAGAAGCAGGCTGAAGCGGG + Intronic
1098487073 12:71033772-71033794 ATGGAGAAGCAGACAAAGTTGGG + Intergenic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098860050 12:75698786-75698808 AGGAATAAGCAGACAGAAGCTGG + Intergenic
1099155087 12:79164827-79164849 ATGGTGATGTAGACAGAACCCGG + Intronic
1099913029 12:88856708-88856730 ATGGATCAGCTGACTGAAGCTGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100922119 12:99499926-99499948 ATTGGGCAGCAGACAGAAGCTGG + Intronic
1102338083 12:112099663-112099685 TTGGAGATGCAGGCAGCAGCAGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103492999 12:121337712-121337734 ATCTAGAAGGTGACAGAAGCAGG - Intronic
1103687005 12:122740078-122740100 TGGCAGAAGGAGACAGAAGCAGG + Intergenic
1103706959 12:122880403-122880425 ACGGAGACACAGACACAAGCTGG + Intronic
1104179797 12:126368193-126368215 ATGGAGAAGCAGAGACCATCAGG + Intergenic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105821564 13:24085421-24085443 ATTAAAAAGCAGGCAGAAGCTGG - Intronic
1106289906 13:28350969-28350991 ATGGAGAAACAGAGAGACGGTGG - Intronic
1106777983 13:33026892-33026914 ATCAAGAAGCAGAGAGAAGCTGG - Intronic
1107658240 13:42613658-42613680 ATGGAGCAGGCTACAGAAGCAGG + Intergenic
1107726307 13:43303337-43303359 GCAGAGAAGCAGATAGAAGCTGG - Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108815518 13:54286320-54286342 TTGGACAAACTGACAGAAGCCGG - Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109078714 13:57870426-57870448 ATGGAGCAGAATACAGAACCCGG + Intergenic
1110277256 13:73653873-73653895 AGTGAGAGGCAAACAGAAGCAGG + Intergenic
1112525275 13:100140658-100140680 TTGGAAAAGCAAACAGTAGCAGG - Intronic
1113024394 13:105924130-105924152 ATGGAGAAACAGACAGTTGGCGG - Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1114401749 14:22416486-22416508 ATGTAGAGGCAGAGAAAAGCTGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1115018741 14:28649252-28649274 ATCGAGAAACAGACAGAATGGGG + Intergenic
1115277876 14:31628020-31628042 ATGCAAAAGTAGACAGAATCTGG - Intronic
1116312200 14:43341633-43341655 ATGGATAAACTGACAGAAGTAGG - Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117949451 14:61067156-61067178 ATATAGAAAGAGACAGAAGCTGG - Intronic
1118149806 14:63177773-63177795 ATGGAGAAAGAAACAGAAACAGG - Intergenic
1118519561 14:66567141-66567163 ATGAATAAGAAAACAGAAGCAGG + Intronic
1118587282 14:67366775-67366797 AATGAGAAGCAGCCAAAAGCAGG + Intronic
1119983440 14:79108457-79108479 ATGGAGAACCATACATTAGCTGG + Intronic
1120739777 14:88095259-88095281 ATGAAGAAGAAGACAGAAACTGG - Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121171904 14:91861624-91861646 ATGCAGAAGTAAACAGGAGCTGG + Intronic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1124421592 15:29527693-29527715 ATGGAGAAGCTTATAGAAGCTGG + Intronic
1124598715 15:31113268-31113290 AGGGAGGAGCAGGCAGAATCAGG - Intronic
1125227629 15:37413042-37413064 ATTGAGAAGCAGGCAGAAGGGGG - Intergenic
1126041526 15:44595662-44595684 ACCAAGAAGCAGACAGAAGGGGG + Intronic
1126923514 15:53555115-53555137 ATGGAGAAGCAAAGAATAGCAGG + Intronic
1127956607 15:63859298-63859320 GCAGAGAAGAAGACAGAAGCAGG - Intergenic
1128073583 15:64812420-64812442 AAGGAGAGGCAGAGAGAAGGAGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1129029280 15:72606763-72606785 GTGAAGAAGCAGACATAAACAGG - Intergenic
1129037220 15:72657807-72657829 GTGAAGAAGCAGACAGAAACAGG - Intronic
1129212667 15:74079419-74079441 GTGAAGAAGCAGACAGAAACAGG + Intronic
1129312400 15:74721843-74721865 TTGCAGAGGCAGAGAGAAGCTGG - Intronic
1129313033 15:74725613-74725635 AGGGAGAAGCAGCCTGAACCGGG + Intergenic
1129397732 15:75261667-75261689 GTGAAGAAGCAGACAGAAACAGG - Intronic
1129401343 15:75285944-75285966 GTGAAGAAGCAGACAGAAACAGG - Intronic
1129474936 15:75778638-75778660 GTGAAGAAGCAGACATAAACAGG - Intergenic
1129729812 15:77923741-77923763 GTGAAGAAGCAGACAGAAACAGG + Intergenic
1129838709 15:78730241-78730263 GTGAAGAAGCAGACAGAAACAGG - Intergenic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130353333 15:83109574-83109596 ATGGGGAAGCAGACAGTAGGAGG - Intronic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1131296077 15:91150301-91150323 ATAGAGAGACAGACAGAAGCCGG - Intronic
1132420236 15:101659586-101659608 ATGGAGAGGGAGACAGGAGGTGG - Intronic
1132451744 15:101972555-101972577 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1132455148 16:18074-18096 ATGGAGAAGATCACAGAGGCTGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133392770 16:5422830-5422852 AGGGAGGAGCAGAGAGAAGGAGG + Intergenic
1133438836 16:5803458-5803480 ATGGATGAGGAAACAGAAGCTGG - Intergenic
1133483099 16:6190996-6191018 ATGCACAAGCAGACAGAATCGGG - Intronic
1134238699 16:12487877-12487899 ATCGAGAAGAAGAGAGAAACTGG + Intronic
1134775569 16:16850376-16850398 TTGAAGAAGTAGACAGAACCTGG + Intergenic
1134826117 16:17285678-17285700 CTGGTGAAGGAGACAGAGGCAGG - Intronic
1135412305 16:22244518-22244540 CTGGAGAGGCAGACAGTATCAGG - Intronic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1136648861 16:31648137-31648159 ATGGAAAAGAATGCAGAAGCTGG + Intergenic
1137379488 16:47984084-47984106 AAGGATAAGCAGACATGAGCTGG + Intergenic
1137561902 16:49507999-49508021 GTGGTGAAGAGGACAGAAGCCGG + Intronic
1137909876 16:52366735-52366757 ATGGAGAAGAATAAAAAAGCTGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139636935 16:68263852-68263874 ATGGAGGAGCAAACAGAGGGAGG + Intergenic
1140016653 16:71193452-71193474 AAGGAGAACCAGACAGAATAGGG + Intronic
1140788631 16:78368051-78368073 AATGAGAAGCTGGCAGAAGCCGG - Intronic
1141000407 16:80302349-80302371 ATGGACAAGCTGATAGAAACCGG - Intergenic
1141348423 16:83270312-83270334 ATGGAGAAGTCGACAGACTCAGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141801123 16:86309957-86309979 TTGAGGAAGCAGACAGAGGCTGG + Intergenic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1142704139 17:1683793-1683815 AGGGAGAAGCAGGCACCAGCAGG + Intronic
1142961633 17:3555496-3555518 ATGGACAGGCAGCCATAAGCTGG - Intronic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1145055351 17:19700003-19700025 AAGGAGAAGCAGCCAGACACAGG + Intronic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1146374407 17:32284633-32284655 AGGGAAAAGCAGACAGCAGCAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146610512 17:34300870-34300892 AATGAGAAACAGAAAGAAGCTGG + Intergenic
1147524718 17:41211045-41211067 ATGGGGTAGGAGACACAAGCAGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149287500 17:55181027-55181049 ATGGAGGTGGAGACAGATGCAGG + Intergenic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1150649852 17:67002698-67002720 TTGTAGGATCAGACAGAAGCAGG + Intronic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151930512 17:77228993-77229015 AAGGAGAAGGAGACAGACGTGGG - Intergenic
1152250198 17:79208499-79208521 CTGGGGAAACAGCCAGAAGCTGG - Intronic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152418738 17:80180356-80180378 ATGGCGAGGCAGACAGAGGGTGG - Intronic
1152437098 17:80283167-80283189 ATGGAAAAGCAGACAGCAGGAGG + Intronic
1152868658 17:82738730-82738752 ATGGGGAGGGAGACAGAAACAGG + Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1154110090 18:11560248-11560270 ATGAAGAAAGAGACAGCAGCAGG - Intergenic
1155343708 18:24838118-24838140 ATGGAGAGGAAGAGAGAAGGTGG + Intergenic
1156113254 18:33754137-33754159 ATGAAGAAGAAGAAAGAAACTGG - Intergenic
1156160832 18:34356208-34356230 ATGGAGATGCAGGCAGAGACGGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157423231 18:47563374-47563396 AACAAGAGGCAGACAGAAGCAGG - Intergenic
1157498488 18:48172788-48172810 AGCGAGAAGCAGACAGGACCAGG - Intronic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1157813650 18:50716029-50716051 ATGGAGGACAAGACATAAGCTGG - Intronic
1158186713 18:54779913-54779935 AGGGAGAAGCAGTCAGGAGACGG - Intronic
1158186740 18:54780015-54780037 ATGGGGAAGCAGTCAGGAGAAGG - Intronic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158713188 18:59855147-59855169 TGGGAGAAGCAGACAGCAACAGG - Intergenic
1159076782 18:63689187-63689209 ATGGAGGAACTGACAGAAGCAGG + Intronic
1159634786 18:70791235-70791257 ATTCATAAGCAGACAAAAGCAGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160333563 18:78017303-78017325 CCGGAGAAGCAGCTAGAAGCAGG + Intergenic
1160789999 19:918863-918885 AGGGAGATGCACTCAGAAGCTGG + Intronic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1163212957 19:15854945-15854967 ATGGGCAGGCAGACAGAGGCAGG + Intergenic
1164067657 19:21734214-21734236 ATGGATAAACTGACAGAAGTAGG + Intronic
1164147850 19:22523408-22523430 GTGAAGAAGCAGACATAAACAGG + Intronic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164629044 19:29749190-29749212 CTGGAGAAGGACACAGAGGCAGG - Intergenic
1164742275 19:30584584-30584606 ATGGATTGGCAGAGAGAAGCTGG - Intronic
1164825911 19:31284699-31284721 ATGGATAAGGGGACAAAAGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167511324 19:49896757-49896779 ACTGAGAAGCAGTCAGGAGCTGG - Intronic
925083387 2:1088324-1088346 ATGAAGAAGCACACAGAAACTGG - Intronic
925673597 2:6337365-6337387 ATGGAGAAACAAGCAGAAGGTGG + Intergenic
926373362 2:12202925-12202947 ATAGCAAAGCAGACAGCAGCAGG + Intergenic
926705028 2:15831038-15831060 ATGAAGAGACAGACAGAAGGTGG + Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
926910548 2:17848833-17848855 GTGCAGAAGCAAACAGAAGGAGG + Intergenic
928218472 2:29382280-29382302 ATAGAAAAGCAGACAGGAACGGG + Intronic
928412375 2:31065040-31065062 ATGGAGGAGTGGCCAGAAGCAGG + Intronic
928617110 2:33051776-33051798 ATGTAGAAGCAGACATAAAGTGG - Intronic
928846724 2:35683017-35683039 ATGGAGAATGAGACAAGAGCAGG - Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929993708 2:46811869-46811891 AAGGAGAAGGAGACAAAAGAAGG - Intergenic
929998653 2:46846417-46846439 AGGGAGAAGCAGGCATAAGAGGG + Intronic
930551190 2:52836662-52836684 ATCCAGAAGCAGAAAGGAGCAGG + Intergenic
930818536 2:55622473-55622495 CTGGAGAGGTAGGCAGAAGCAGG - Intergenic
931284442 2:60820390-60820412 ATGGATAGAGAGACAGAAGCAGG + Intergenic
931820359 2:65945501-65945523 ATGAAGAAGTAGACAAAAACTGG - Intergenic
931867314 2:66426465-66426487 AAGCAGCAGAAGACAGAAGCCGG + Intergenic
933205038 2:79497427-79497449 ATGCAGAAGATGACAGCAGCAGG - Intronic
935941639 2:108245081-108245103 ATGGAGAAGAAAACAGTAGAGGG + Intergenic
935946955 2:108295384-108295406 ATGGTTAAGCAGGCAGAGGCTGG - Intronic
936567955 2:113595022-113595044 ATGGAGAAGATCACAGAGGCTGG - Intergenic
937599804 2:123717780-123717802 ATGGATAAGCATAGAAAAGCAGG - Intergenic
937893828 2:126962590-126962612 ATGGACAAACTGACAGAAGTAGG - Intergenic
938303616 2:130233207-130233229 GTGGAGAGGTAGCCAGAAGCTGG - Intergenic
938453063 2:131441052-131441074 GTGGAGAGGTAGCCAGAAGCTGG + Intergenic
938949953 2:136246238-136246260 AGGGAGAGGCAGAGGGAAGCCGG + Intergenic
939031884 2:137086450-137086472 TCAGAGAAGGAGACAGAAGCAGG - Intronic
940636372 2:156302427-156302449 ATGGGTATGGAGACAGAAGCAGG - Intergenic
940802053 2:158144151-158144173 ATGGGGAAGCAGACACACCCAGG + Intergenic
941694239 2:168534209-168534231 ATGGACAAACTGACAGAAGTAGG - Intronic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
942063949 2:172252687-172252709 ATGGAGAAGCAGAGATGACCAGG - Intergenic
942064800 2:172260562-172260584 ATGGAAAAGCTGAGACAAGCTGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
943514173 2:188863397-188863419 ATGGACAAATTGACAGAAGCAGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944206093 2:197160362-197160384 AAGGAGATGCAGACAGATCCTGG + Intronic
944385243 2:199155962-199155984 ATGGACAAGTTGACAGAAGTAGG + Intergenic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946857004 2:223960355-223960377 TTGGAAGAGCAGACAGCAGCTGG - Intronic
947357543 2:229312536-229312558 ATGGAGAAGAGGACAGCAGGAGG - Intergenic
948676785 2:239601534-239601556 GTGGGGAAGCAGGCAGGAGCTGG - Intergenic
1168733993 20:114705-114727 ATGGAAAAGAATACAGAATCCGG - Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169940833 20:10935271-10935293 GAGGAGAAGCAGAAAAAAGCTGG - Intergenic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171353175 20:24521238-24521260 ATGCAGAAGTAGTCAGAAGGTGG - Intronic
1171971977 20:31570251-31570273 GTGGGGAAACAGACAGGAGCGGG + Exonic
1172494234 20:35367271-35367293 CTGTAGAAGCACACGGAAGCTGG - Intronic
1172606917 20:36220231-36220253 AGGGAGGAGAAGACAGATGCGGG + Intronic
1173619535 20:44426206-44426228 ACAGAGAAACAGAAAGAAGCGGG + Intronic
1174036650 20:47672631-47672653 TTTTAGGAGCAGACAGAAGCAGG - Intronic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1175175387 20:57108808-57108830 ATGAAGAAGGAGGCAGAGGCAGG - Intergenic
1175412182 20:58777617-58777639 GTGGAGAAGCAGACAGCTGTTGG - Intergenic
1176843278 21:13857464-13857486 AGGGAGTAGCAGACAGAGGTCGG - Intergenic
1176864603 21:14038812-14038834 GTGGAGAAGCAGAGAAAATCTGG - Intergenic
1178301461 21:31456876-31456898 AGAGAGAGGCAGACAGAATCAGG - Intronic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178755809 21:35348419-35348441 ATGGAGAAGGATGGAGAAGCAGG + Intronic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179941802 21:44644529-44644551 AAAGAGAAGCAGACAGAAACAGG + Intronic
1180280644 22:10690582-10690604 AGAGAGAAGCCAACAGAAGCTGG - Intergenic
1181497771 22:23297534-23297556 ATGGAGAGGGAGAGAGAAGTGGG - Intronic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182185597 22:28398344-28398366 ATGGAGAGGGAGCCAGAAGAGGG + Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183412823 22:37665522-37665544 ATGGAGACGCAGTCAGCAGGAGG - Intronic
1183703369 22:39462468-39462490 ATGGAGAAGGAGTAATAAGCAGG - Intronic
1183723707 22:39576869-39576891 GAGCAGAAGCAGACAGAAGTCGG - Intronic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
949204642 3:1423501-1423523 AGGGAGAGGCAGACTGATGCAGG - Intergenic
949645556 3:6089553-6089575 ATGGGGTAGTAGACAGTAGCAGG - Intergenic
949690947 3:6638397-6638419 ATGGGGAAGAAAACAGAAGAAGG + Intergenic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
949808257 3:7978472-7978494 ATGGACAGGGAGCCAGAAGCGGG + Intergenic
950105972 3:10388680-10388702 GGGGAGAAGGAGACAGAAGGAGG - Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
951110841 3:18802043-18802065 ATGGGGAAGCAGCCAGATGGAGG - Intergenic
952277326 3:31889973-31889995 ATTGAGAAGCAGAGAGCAACTGG - Intronic
952482781 3:33778810-33778832 ATGGCAAAGCAGAAAGAACCTGG - Intergenic
952740920 3:36733549-36733571 GTGGGGAAGCAAACAGGAGCTGG - Intronic
953827402 3:46265769-46265791 AGGGAGAACGAGACAGAAGATGG - Exonic
954625502 3:52019978-52020000 GTGGAGGGGCAGAGAGAAGCGGG + Intergenic
955129788 3:56154450-56154472 ATGAAGAATGAGTCAGAAGCAGG - Intronic
956582512 3:70830184-70830206 ATGTAGTAGGAGACAGAAACAGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
958259977 3:91368896-91368918 CTGGAGAGGTAGACAGAACCAGG + Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959749449 3:109815664-109815686 ATGGAAAAACAGATATAAGCAGG + Intergenic
960050975 3:113239323-113239345 GCGGAGAAGCAGGGAGAAGCAGG + Intronic
960406298 3:117264507-117264529 ATTGGGAGGCAGCCAGAAGCAGG + Intergenic
960525482 3:118705086-118705108 AGAGAGGAGCAGATAGAAGCAGG + Intergenic
960728484 3:120696923-120696945 ATGGAATGGCAGGCAGAAGCTGG + Intronic
960949264 3:122988492-122988514 TTGGACAGGCAGACAGCAGCAGG + Intronic
960969134 3:123126667-123126689 ATGGAGAAACCTAGAGAAGCAGG - Intronic
961235183 3:125360193-125360215 ATGGAGAAGCTGATAGGATCTGG - Intronic
961314480 3:126025344-126025366 AAGGAGCAGCAGACAGCAGGTGG + Intronic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962526161 3:136239429-136239451 TTGGAAAGACAGACAGAAGCAGG - Intergenic
963074467 3:141333375-141333397 AGAGACAGGCAGACAGAAGCAGG - Intronic
963124238 3:141800107-141800129 ATAAAGAACCAGACAGAAGCAGG + Intronic
963942767 3:151111548-151111570 ATGGAGATGCAGACAAGAGTGGG - Intronic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
965406446 3:168275096-168275118 ATAGAGCAGCAGACAGGAGCTGG + Intergenic
967182193 3:186915570-186915592 AAACAGAAGCAGACAGAATCCGG - Intergenic
967815560 3:193795589-193795611 ACGAAGAAGCAGACAGAGTCAGG - Intergenic
968483071 4:845386-845408 CTGGAGATGAAGACATAAGCAGG + Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
968692246 4:1998295-1998317 ATGGACGAGCTGACAGAAGTAGG + Intronic
969520928 4:7677431-7677453 AGGCAGACGCAGACATAAGCAGG + Intronic
969632673 4:8347468-8347490 ATGGAGAAACAGGCAGCAGCTGG - Intergenic
969977738 4:11121681-11121703 ATGCAGAAGCACACATAATCAGG - Intergenic
971001950 4:22333144-22333166 AAGGAGAAGCAGGCAGGAGCTGG - Intergenic
971381908 4:26106882-26106904 GTGGAGAAGGAAACAGAAGGGGG + Intergenic
972866631 4:43241263-43241285 ATGCAGAAGCAGCCAGATGATGG - Intergenic
973118884 4:46492921-46492943 ATAGCTAAGCAGACATAAGCAGG - Intergenic
974387654 4:61223730-61223752 ATAGGGAAGCAGACAGAAACTGG - Intronic
974396616 4:61344493-61344515 AGGGAATAGTAGACAGAAGCAGG - Intronic
975050104 4:69852474-69852496 ATGGGGAAGAAGGAAGAAGCGGG - Intronic
975543245 4:75535787-75535809 ATGGAAAATCAGACATGAGCTGG + Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
978517686 4:109586444-109586466 TTTGAGAAGCTGACAGAAGTAGG - Intronic
979159276 4:117438318-117438340 ACGGAGGAGGAGACAGAAACAGG + Intergenic
980773610 4:137411151-137411173 ATTGAGAAGCAGAGAGAACTTGG - Intergenic
981120131 4:141040025-141040047 ATGGAGAAGGAAAAAGGAGCGGG - Intronic
981321045 4:143391597-143391619 ACAGAGAAGCACAGAGAAGCGGG + Intronic
981713097 4:147728161-147728183 ATGGAAATCCAGACAGAAGGTGG - Intergenic
982000488 4:151016826-151016848 CTTGAGAAGTGGACAGAAGCCGG + Intergenic
982097620 4:151937040-151937062 ATGATGAAGCAGAGAGATGCAGG - Intergenic
983047856 4:163008115-163008137 CTGGAGAAACAGACATAAACTGG + Intergenic
983956366 4:173703222-173703244 ATGGATTTGCAGTCAGAAGCTGG + Intergenic
984792484 4:183627359-183627381 ATGGAGAGTCAGATAGTAGCAGG - Intergenic
985179466 4:187240917-187240939 ATAGAAAAGGAGAGAGAAGCTGG + Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
986011763 5:3723713-3723735 ATGGATAAACTGACAGAAGCAGG - Intergenic
986264743 5:6182066-6182088 GTGCAGAAGGTGACAGAAGCTGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987634921 5:20526926-20526948 ATGGACAAACCGACAGAAGTAGG + Intronic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
990494956 5:56338072-56338094 AAGAAGAAGAAGACAGAAGGAGG - Intergenic
990622315 5:57573374-57573396 ATGTTCCAGCAGACAGAAGCAGG + Intergenic
990748894 5:58990384-58990406 ATGGATATGAAGAAAGAAGCAGG + Intronic
990878580 5:60516402-60516424 ATGGAGAGCCAGACAGAGACAGG - Intronic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
992107928 5:73465422-73465444 ATGCAGTAGCAGAAACAAGCTGG - Intergenic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993365410 5:87029441-87029463 ATGGATGAACTGACAGAAGCAGG - Intergenic
993908338 5:93649321-93649343 TTGGAGAAGCAACCAAAAGCAGG + Intronic
995652006 5:114380279-114380301 ATGGACCACCAGAAAGAAGCAGG - Intronic
995705270 5:114982326-114982348 ATGGTGAGGCAGAAAGAACCTGG + Intergenic
995798483 5:115965270-115965292 GAGGAGAAGAAGGCAGAAGCTGG + Intronic
996281044 5:121729247-121729269 AAGGAGGAGAAGACAGAAGGAGG - Intergenic
996337485 5:122400633-122400655 ATGGAGAAGCAGAACACAGCTGG + Intronic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
996590897 5:125146941-125146963 AGGAAGAAGCAGGGAGAAGCAGG - Intergenic
996829828 5:127727692-127727714 ATGGATAAACTGACAGAAGTAGG + Intergenic
997283190 5:132661304-132661326 CTGGTGCAGCAGACAGAAGGTGG - Intergenic
998262628 5:140642908-140642930 ATGGAGCTGCTGGCAGAAGCAGG - Exonic
998494639 5:142577127-142577149 ATCCAAAAGCAGATAGAAGCAGG - Intergenic
998976806 5:147657996-147658018 ATGGACAAGTTGACAGAAGTAGG - Intronic
999303495 5:150505397-150505419 ATTAAGAACCAGACAGATGCTGG + Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999536570 5:152523810-152523832 ATAGAGAAGCAGGCAGATACTGG + Intergenic
999597026 5:153215711-153215733 ATGGACAAAGTGACAGAAGCAGG + Intergenic
999938853 5:156518158-156518180 ATGGAAAAACAGAAAAAAGCAGG + Intronic
1000046786 5:157528397-157528419 AGGAAGAGGCAGACAGAAGCAGG + Intronic
1001309573 5:170601359-170601381 CAGGAGAAGGAGGCAGAAGCTGG + Intronic
1001344159 5:170875737-170875759 ATGGACAAACTGACAGAAGTAGG - Intronic
1001857064 5:175022114-175022136 TTTGAGAAACAGAAAGAAGCGGG + Intergenic
1002492469 5:179588469-179588491 AGGGAAAAGCATAGAGAAGCAGG - Intronic
1002596468 5:180327223-180327245 GTGGAGAGGCGGACAGAGGCCGG - Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003686968 6:8314321-8314343 ATGGACAAACTGACAGAAGTAGG - Intergenic
1006489477 6:34374640-34374662 ATGGAGGAGTAGACAAATGCTGG - Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1006945731 6:37783486-37783508 ATGGAGAAGCTGACTCCAGCCGG + Intergenic
1006960630 6:37926432-37926454 ATGAAGATGGAGGCAGAAGCTGG - Intronic
1007154410 6:39728532-39728554 ATTGAGAAGAAGAGAGAACCAGG + Intergenic
1007274803 6:40665467-40665489 ATGGAGAAGCAGTCAAAAGGGGG + Intergenic
1007484395 6:42170852-42170874 GTGGAGAAGCTGACTGAAGCAGG + Intronic
1008122443 6:47633865-47633887 GTGGAGAGGGAGACAGAATCAGG - Intergenic
1008414430 6:51223489-51223511 ATGAGGAAGCAGATAGAATCTGG - Intergenic
1008861497 6:56154548-56154570 ATGGAGAAGTAGTCAGATTCTGG - Intronic
1008995262 6:57651510-57651532 CTGGAGAGGTAGACAGAACCAGG - Intergenic
1009183796 6:60550270-60550292 CTGGAGAGGTAGACAGAACCAGG - Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1010345585 6:74806414-74806436 ATGTAGAAGTAGTCAGGAGCTGG - Intergenic
1010495930 6:76533483-76533505 ACGGAAAAGCAGCCAGAGGCAGG - Intergenic
1011412453 6:87080050-87080072 CTGAAGAAGCAGCCAGAAGCTGG - Intergenic
1012986167 6:105878432-105878454 ACGGAGAAGAAAAGAGAAGCTGG + Intergenic
1013700904 6:112768239-112768261 GAGGAGAAGCAGACAGGAGGTGG - Intergenic
1014208023 6:118678145-118678167 ATGGAGAAGGAAACAGAATTAGG + Intronic
1015198581 6:130552489-130552511 AGGGAGAAGAGAACAGAAGCAGG - Intergenic
1016799221 6:148152160-148152182 ATGTAAAAGCAGAGATAAGCAGG + Intergenic
1016828109 6:148406659-148406681 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828114 6:148406689-148406711 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828123 6:148406749-148406771 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828128 6:148406779-148406801 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828139 6:148406839-148406861 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828144 6:148406869-148406891 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828154 6:148406929-148406951 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1017027215 6:150192012-150192034 ATTGAGAAACAAACAGAATCTGG - Intronic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018438255 6:163782759-163782781 ATGAAGGAGCAGTCAGAGGCTGG + Intergenic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020932343 7:14413582-14413604 AAGGAGAAGAAGCCTGAAGCGGG + Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023707687 7:42959330-42959352 ACAGAGAGACAGACAGAAGCAGG + Intergenic
1024034255 7:45494446-45494468 ATGGATGAGCTGACAGAAGAAGG - Intergenic
1024798767 7:53051293-53051315 TTGGTGAAGCTGAAAGAAGCTGG - Intergenic
1024913207 7:54469873-54469895 TTGGAGAAGCAGCCAGAGCCAGG + Intergenic
1025233906 7:57220790-57220812 CTGGAGAACCAGAGAGGAGCCGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027831988 7:83188774-83188796 AGGGAGTAGCAGAAACAAGCTGG + Intergenic
1028925418 7:96352162-96352184 ATGGAGATGCAGAGAAAAACAGG + Intergenic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029263679 7:99322280-99322302 AGGGGGAAGCAAAAAGAAGCAGG + Intergenic
1029799007 7:102926012-102926034 ATGGGGGACCAGAAAGAAGCAGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030688834 7:112512178-112512200 ATGGAGAAGCACATAGACGGAGG - Intergenic
1030786653 7:113671204-113671226 ATGTGAAAGCAGCCAGAAGCAGG + Intergenic
1030986699 7:116250188-116250210 AAGGAAAAGCAGCCAGTAGCAGG + Exonic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031897234 7:127364639-127364661 GTGGACAGGGAGACAGAAGCTGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033673210 7:143512325-143512347 AGGCAGGAGAAGACAGAAGCGGG - Intergenic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1033838635 7:145346780-145346802 AAGGGGAAGCAGAAAGAATCAGG - Intergenic
1034039998 7:147867939-147867961 ATTGACAAGCTGACAGAAGTAGG - Intronic
1034344482 7:150378267-150378289 AGGTAGATACAGACAGAAGCTGG - Intronic
1034948230 7:155278025-155278047 AGGGAGAAGCAGGCAGACCCTGG - Intergenic
1035020502 7:155797460-155797482 CTGGAGAAGCAGCCAGGAGCTGG + Intergenic
1035352515 7:158256552-158256574 GTGGTGGAGGAGACAGAAGCTGG + Intronic
1035818388 8:2564865-2564887 ATTGAGAAACAGAGAGAAGGTGG + Intergenic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1037664664 8:20957388-20957410 GTGGAGAAACTGACAGAAGTAGG + Intergenic
1037784379 8:21893723-21893745 ATGGAGAAAAATACAGCAGCGGG - Intergenic
1038426767 8:27468972-27468994 ATCACGAAGCAGAGAGAAGCTGG - Intronic
1038447416 8:27613512-27613534 TTGAAGAAGCAGATAGGAGCCGG - Intronic
1038535704 8:28351623-28351645 GTGGAAGAGCAGACAGAGGCAGG + Exonic
1038854379 8:31315093-31315115 ATAGAAAAGCAAACTGAAGCAGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039490766 8:37945840-37945862 ATGCAGATGCAGAGAGAAGTTGG + Intergenic
1040892410 8:52330938-52330960 ATGGAGAGGCAGACAGACAGAGG + Intronic
1041021273 8:53641713-53641735 ATGGACAAACTGACAGAAGTAGG - Intergenic
1041034355 8:53773441-53773463 AAATAGAAGCAGACAGAATCTGG + Intronic
1041099259 8:54379958-54379980 TTGGAGATGCAGGCAGCAGCTGG - Intergenic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1042630082 8:70806417-70806439 ATGGACAAATAGACAGAAGTAGG + Intergenic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042809433 8:72807518-72807540 ATGCAAAGGCAGATAGAAGCAGG - Intronic
1042938622 8:74085575-74085597 TTGGAAAAGCAGAAAGGAGCTGG - Intergenic
1043642990 8:82480778-82480800 GTGGAGAAGCATTCACAAGCTGG - Intergenic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1043940729 8:86192851-86192873 AGGGAGATGCAGACAAAATCAGG - Intergenic
1044386534 8:91595476-91595498 ATGGAGCAGGAGACAGACCCAGG + Intergenic
1044636610 8:94331607-94331629 ATGGACAAGCAGAGAGCAGCAGG - Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1045714237 8:105022736-105022758 ATGGAGAAGTAGCTAGAAACAGG - Intronic
1046750577 8:117922610-117922632 AAGGAGAACAAGAGAGAAGCTGG + Intronic
1046877289 8:119269625-119269647 ATGGAAAAGAAAACGGAAGCAGG - Intergenic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047402330 8:124557504-124557526 GGGGAGAAGCAGAAAGCAGCCGG - Intronic
1048059221 8:130900278-130900300 ATGGTCAGGCAGACAGAAACTGG + Intronic
1048374630 8:133812500-133812522 ATAGACAAGCAGAGAGAAGTGGG - Intergenic
1048838783 8:138546706-138546728 AGGGAGGAGAGGACAGAAGCAGG + Intergenic
1049124745 8:140776632-140776654 GTGGAGAAGGGGAGAGAAGCAGG + Intronic
1049324419 8:142014618-142014640 ACGGAGACACAGACAGGAGCAGG - Intergenic
1049444072 8:142622040-142622062 ATGGAGATGCAGAGAACAGCAGG - Intergenic
1049630491 8:143652518-143652540 TAGGAGCAGCAGACAGTAGCAGG - Exonic
1049884575 9:18498-18520 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050836078 9:10080252-10080274 AAGGAAAATCAGACAGGAGCAGG + Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1053061904 9:35038368-35038390 AAGGAGTAGGAGACAGAAACTGG + Intergenic
1053639458 9:40056571-40056593 ATGGAGACGCACTCAGAAGGGGG - Intergenic
1056231801 9:84554144-84554166 AGGGAGAAGCTGAGATAAGCTGG + Intergenic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057698260 9:97342680-97342702 ATTGAGAAGGAGAGAGAACCAGG - Intronic
1057712710 9:97461762-97461784 ATGCTGAAGCAAACAGAATCTGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057894616 9:98898752-98898774 CTCGAGAAGAAGACAGGAGCAGG + Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1058438074 9:104982189-104982211 ATTGAGAAAGAGACAGAATCAGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058994952 9:110290629-110290651 AGTGAGAAGCAGACAGAAGTGGG - Intergenic
1059281485 9:113137881-113137903 ATGGTGAAGCAGTCAGAGGCAGG + Intergenic
1059366729 9:113792169-113792191 ATGGAGAAGGAGCTAGCAGCTGG + Intergenic
1059636063 9:116171763-116171785 CTGGAGAGGCAGTCAGATGCTGG + Intronic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1060522354 9:124300944-124300966 AAGGAGCAGCAGCCAGAAACAGG + Intronic
1060804551 9:126566287-126566309 ATGGAGCAGCATCCAGAATCTGG + Intergenic
1061195111 9:129103228-129103250 ATGAAGAAGCACACACAGGCTGG - Intronic
1061395951 9:130343410-130343432 AGGGAGAGGCAGGTAGAAGCAGG + Intronic
1061620500 9:131808467-131808489 AGGGAGAAGCAGCCAGCTGCTGG + Intergenic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1062573872 9:137197691-137197713 AGGGAGAGGCAGACAGGAGCTGG + Intronic
1185513673 X:682028-682050 AGGGAGAAGGAGACAGAAAAAGG + Intergenic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1186175581 X:6922782-6922804 GTAGAGAAGGAGAGAGAAGCTGG - Intergenic
1186495240 X:10007738-10007760 ATGGAGAAGAAGCCAGCTGCAGG - Intergenic
1186715095 X:12243188-12243210 ATGACGAAGCATACAGAAACAGG - Intronic
1186771358 X:12821031-12821053 ATGGAAAAACAGTCAGAAACGGG + Intronic
1186807006 X:13149987-13150009 ATGGAAAAGCTCTCAGAAGCTGG - Intergenic
1186957092 X:14695645-14695667 ATGGTGAAGCACACAGACTCTGG - Intronic
1187295466 X:17995680-17995702 ATGGACAATCAGACTGTAGCAGG - Intergenic
1187714288 X:22086695-22086717 ATGGTGGTGGAGACAGAAGCTGG - Intronic
1188368415 X:29338714-29338736 ATGGAGAGACAGACAGAGACAGG - Intronic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1190136304 X:47802244-47802266 AAGGAGGAACAGACAGGAGCAGG + Intergenic
1192082393 X:68060955-68060977 TAGGAGAAGCAGCCAGAATCAGG + Intronic
1192696137 X:73417892-73417914 ATGGGGTAGCAGGCAGAGGCTGG - Intergenic
1193744840 X:85264792-85264814 ATGAGGAAACAGACAGAAGGGGG - Intronic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1194241852 X:91459022-91459044 GTAAAGAAGCAGACAGCAGCAGG - Intergenic
1194329469 X:92562966-92562988 ATTGGGTAGCAGACAGAAACTGG - Intronic
1194489802 X:94531546-94531568 ATGGACAAGTTGACAGAAGTAGG + Intergenic
1195233828 X:102877693-102877715 ATGGTGAGGCACACAGAAGCAGG + Intergenic
1195301107 X:103530644-103530666 ATGGTGAGGCACACAGAAGCAGG - Intergenic
1195656995 X:107341215-107341237 ATGGAGAAAGAGACAAAAGATGG + Intergenic
1196111660 X:111953100-111953122 ATTGAGCAGCAGCAAGAAGCAGG - Intronic
1197521835 X:127508533-127508555 AGAGAGAAGCAGACAGAATATGG - Intergenic
1198717068 X:139569065-139569087 ATGGTGTAGCAGTCAGAATCAGG + Intergenic
1198720663 X:139615803-139615825 AAGGAGGAGCAGGCAGAAGTTGG - Intronic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199485554 X:148343935-148343957 ATGGAGTAGAAGGCAGAACCCGG + Intergenic
1199713783 X:150491579-150491601 ATGGAGGACCACAAAGAAGCAGG + Intronic
1199721260 X:150544187-150544209 AAAGAGAAGCAGAAAGAATCTGG + Intergenic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1200401231 X:156021653-156021675 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1200638169 Y:5682156-5682178 ATTGGGTAGCAGACAGAAACTGG - Intronic
1200761108 Y:7039907-7039929 ATGGAGAAAATGTCAGAAGCAGG - Intronic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201194513 Y:11478687-11478709 AGGGAGAAGCCACCAGAAGCTGG - Intergenic
1201294944 Y:12454463-12454485 AGGGAGAGGGAGACAGAAGGAGG + Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic