ID: 1032607544

View in Genome Browser
Species Human (GRCh38)
Location 7:133372056-133372078
Sequence CTGAACTTAAAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1165
Summary {0: 1, 1: 2, 2: 12, 3: 177, 4: 973}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032607544 Original CRISPR CTGAACTTAAAAATGGACAA AGG (reversed) Intronic
901377619 1:8850762-8850784 CTCAATTCAAAAATGGGCAAAGG + Intergenic
901912503 1:12471623-12471645 CTGTACTGAAAAATGGGGAAAGG - Intronic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
903863947 1:26384151-26384173 CCAAATTTAAAAATGGGCAAAGG + Intergenic
903955938 1:27025779-27025801 CACAATTTAAAAATGGGCAAAGG - Intergenic
904147485 1:28405156-28405178 CCCAATTTAAAAATGGGCAAAGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904662067 1:32092790-32092812 CTGCACTCTAAAATGGACACAGG - Intronic
905462217 1:38129263-38129285 CTGAACTTAACAAGGGATCATGG + Intergenic
905759226 1:40539906-40539928 CACAATTTAAAAATGGGCAAAGG - Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
906752012 1:48272940-48272962 AGCAATTTAAAAATGGACAAAGG - Intergenic
907083365 1:51645316-51645338 CCCAATTTAAAAATGGGCAAAGG - Intronic
907209709 1:52809836-52809858 CCCAATTTAAAAATGGGCAAAGG - Intronic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909432723 1:75608219-75608241 CCCAACTTAAAAATAGGCAAAGG + Intronic
909695190 1:78460313-78460335 CCCCATTTAAAAATGGACAAAGG - Intronic
910154616 1:84200550-84200572 CTGGACATAAGAATGGACAAAGG - Intronic
910159909 1:84261546-84261568 CTGATTTAAAAAATGGGCAAAGG + Intergenic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
910907358 1:92194779-92194801 CTTAACTTAAAAGTCGCCAAAGG - Intergenic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911214400 1:95176490-95176512 CCCAATTTAAAAATGGGCAAAGG - Intronic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
911586820 1:99700885-99700907 CAAAATTTAAAAATGGGCAAAGG - Intergenic
911630917 1:100182543-100182565 CTCAATTTAAAAATTGGCAAAGG - Intergenic
911935658 1:103967842-103967864 CACAACTCAAAAATGGACCAAGG - Intergenic
912024687 1:105154085-105154107 CTCAATTTAAAAATTGTCAAAGG - Intergenic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
913024114 1:114818456-114818478 CTAAATTTAAAAATGGGTAAAGG - Intergenic
913588375 1:120298737-120298759 CCCAACTAAAAAATGGGCAAAGG + Intergenic
913619810 1:120599632-120599654 CCCAACTAAAAAATGGGCAAAGG - Intergenic
914219257 1:145664000-145664022 CTGAACTTCAATTAGGACAAGGG - Intronic
914383392 1:147141739-147141761 CTTGACTAAAAAATGTACAAAGG - Intergenic
914471840 1:147986870-147986892 CTGAACTTCAATTAGGACAAGGG - Intronic
914570391 1:148910610-148910632 CCCAACTAAAAAATGGGCAAAGG + Intronic
914602438 1:149219659-149219681 CCCAACTAAAAAATGGGCAAAGG - Intergenic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
915614181 1:157023307-157023329 CTTAAATAAAAAATGGGCAAAGG + Intronic
915640659 1:157222328-157222350 TTCAATTTTAAAATGGACAAAGG - Intergenic
915973444 1:160369940-160369962 CCCAATTTAAAAATGGGCAAAGG - Intronic
916493315 1:165321994-165322016 CACAACTTTAAAATGGGCAAAGG + Intronic
916937389 1:169643811-169643833 CCTAATTTAAAAATGGGCAAAGG + Intergenic
917002816 1:170378777-170378799 CTCAATTCAAAAATGGGCAAAGG - Intergenic
917295647 1:173516315-173516337 CTGAACTTAAAACTTAAAAAAGG - Intronic
917420803 1:174861774-174861796 CCCAATTTAAAAATGGCCAAAGG - Intronic
917426101 1:174915753-174915775 CCCAATTTAAAAATGGGCAAAGG - Intronic
917571924 1:176275712-176275734 CTTAACTTTAAAATGGGCAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917705304 1:177627018-177627040 CTCAATTTTAAAATGGGCAAAGG + Intergenic
918173169 1:182018015-182018037 CCCAACTAAAAAATGGGCAAGGG - Intergenic
918306876 1:183254737-183254759 CTCAACTAAAAACTGGGCAAAGG - Intronic
918421622 1:184370027-184370049 CCCAACTTTAAAATGGACAAAGG - Intergenic
918637429 1:186795093-186795115 CCCAATTTAAAAATAGACAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918692025 1:187492926-187492948 CTGCAATTAAAAATGGGCAAAGG - Intergenic
918742664 1:188154759-188154781 TTGAATTTAAAACTGGAGAAGGG - Intergenic
918799095 1:188948599-188948621 ATTAACTTAAAAATGGATGATGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919320045 1:196024689-196024711 CAAAACTTGAAAATGGGCAAAGG + Intergenic
919364850 1:196645910-196645932 CATAATTTAAAAATGGGCAAAGG + Intergenic
919858647 1:201723254-201723276 CACAATTTAAAAATGGGCAAAGG - Intronic
920410607 1:205757233-205757255 CCCAAATAAAAAATGGACAAAGG - Intergenic
920595605 1:207266676-207266698 TTCAATTTAAAAATGGGCAAAGG + Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
920754112 1:208711697-208711719 CCCAATTTAAAAATGGGCAAAGG - Intergenic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921115891 1:212091120-212091142 CCTAATTTTAAAATGGACAAAGG + Intronic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921762765 1:218936303-218936325 AAGAATTTAAAAATGAACAAAGG - Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922065054 1:222129058-222129080 TCCAACTTAAAAATGGGCAAAGG + Intergenic
922092106 1:222405774-222405796 CTCATATTAAAAATGGATAATGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922380777 1:225022421-225022443 CTCCACTAAAAAATGGGCAAAGG + Intronic
922655265 1:227376773-227376795 CTCAATTTGAAAATGGGCAAAGG - Intergenic
922737038 1:227991979-227992001 CTTGACTAAAAAATGGGCAAAGG + Intergenic
922815779 1:228447776-228447798 CTAACTTTAAAAATAGACAAAGG - Intergenic
922825661 1:228516372-228516394 CTCCATTTAAAAATGGGCAAAGG - Intergenic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923428857 1:233900518-233900540 CCCAATTAAAAAATGGACAAAGG + Intergenic
923691111 1:236193693-236193715 CCCAGTTTAAAAATGGACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924275079 1:242377693-242377715 CTCAATTTAAAAATGAGCAAAGG + Intronic
924658046 1:245991534-245991556 GTCAACTCAAAGATGGACAAAGG + Intronic
924951017 1:248883421-248883443 CTCCATTTAAAAATGGGCAAAGG - Intergenic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1062775383 10:141343-141365 CTGAACTGAAAACTCTACAATGG - Intronic
1062822430 10:544755-544777 TCCAATTTAAAAATGGACAAAGG - Intronic
1063092840 10:2883016-2883038 ATGAATTTAAATATGGACATGGG - Intergenic
1063518328 10:6718359-6718381 CTGCACTGAAAAATGGACCCAGG + Intergenic
1063721870 10:8591251-8591273 CTGAAATTCAAAATGGTCATTGG - Intergenic
1063766473 10:9147183-9147205 CCCAACTTATAAATGGGCAAAGG - Intergenic
1063927035 10:10989831-10989853 CTGACCATAAAAGTAGACAAAGG + Intergenic
1064157157 10:12912443-12912465 CTGATTTAAAAAATGGGCAAAGG - Intronic
1064367669 10:14722644-14722666 ATCAATTTAAAAATGGGCAAAGG - Intronic
1064508774 10:16065792-16065814 CACAATTTAAAAATGGGCAAAGG - Intergenic
1064610519 10:17095422-17095444 CCAATCTTAAAAATGGGCAAAGG + Intronic
1064855462 10:19762346-19762368 AAAAAATTAAAAATGGACAAAGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1064986998 10:21220818-21220840 CCTAATTTTAAAATGGACAAAGG + Intergenic
1065401646 10:25309378-25309400 CTGAATTCAAAAGTGGGCAAAGG - Intronic
1065439228 10:25732650-25732672 CCCAATTAAAAAATGGACAAAGG - Intergenic
1065554761 10:26904485-26904507 CTGAACTATACAATGCACAATGG + Intergenic
1065710873 10:28516400-28516422 CCCAAGTTAAAAATGGGCAAAGG - Intergenic
1065743515 10:28817906-28817928 CTGAAATTAAAAAGGGAGAAGGG - Intergenic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066498754 10:35970038-35970060 ATGAACATAAACATGGACACTGG + Intergenic
1066536079 10:36393685-36393707 CACAATTTAAAAATGGCCAAAGG + Intergenic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067174385 10:43932666-43932688 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1067259172 10:44672290-44672312 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1067813357 10:49449296-49449318 ATAACTTTAAAAATGGACAAAGG - Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068442327 10:57073982-57074004 CTGAAGTTAAAAACATACAATGG - Intergenic
1068563338 10:58542674-58542696 CAAAATTTAAAAATGGGCAAAGG + Intronic
1068655344 10:59568872-59568894 CCCAACTAAAAAATAGACAAAGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1070058485 10:72957881-72957903 CCCAATTGAAAAATGGACAAAGG - Intergenic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070357014 10:75649943-75649965 CTCAATTCAAAAATGGGCAAAGG - Intronic
1070443818 10:76474543-76474565 CTCATTTTAAAAATGGTCAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071253809 10:83848477-83848499 TTGATTTTAAAAATGGGCAAAGG + Intergenic
1071542157 10:86495811-86495833 CTCAATTCAAAAATGGGCAAAGG + Intronic
1071618861 10:87099936-87099958 CCTGACTTAAAAATGGGCAAAGG - Intronic
1071833646 10:89396900-89396922 CCCAATTTAAAAATGGGCAAAGG - Intronic
1071959201 10:90793224-90793246 CCCAATTTAAAAATGGGCAAAGG + Intronic
1072177719 10:92945194-92945216 CTGAATTAAAAAGTGGGCAAAGG - Intronic
1072232962 10:93428621-93428643 ATGAACAGAAAAATGGAAAAAGG - Intronic
1073479584 10:103778026-103778048 CTGAAGTTAAAAAGGGAAAATGG + Intronic
1073676269 10:105650379-105650401 CTGCACTTTAAAATAGAAAAGGG + Intergenic
1073690758 10:105807019-105807041 CAGAACTGAAAAAGGGATAATGG - Intergenic
1073723381 10:106200994-106201016 CTGAACAGAAAAATGATCAAAGG - Intergenic
1073978824 10:109131125-109131147 TTCAATTTAAAAATGGACATTGG - Intergenic
1074029567 10:109672606-109672628 ATGAAATCAAAAATGGGCAAAGG + Intergenic
1074104763 10:110381061-110381083 AAAAAATTAAAAATGGACAAAGG - Intergenic
1074245354 10:111685492-111685514 TTTTACTTTAAAATGGACAAAGG - Intergenic
1074304069 10:112260299-112260321 CCCAACTTAAAAATGGCCAAAGG + Intergenic
1074641608 10:115390019-115390041 CACAATTTTAAAATGGACAAAGG - Intronic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1074806017 10:117053430-117053452 CTCAATTTAAAAATGGGGAAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075215837 10:120533338-120533360 CCGGATTTAAAAATGGGCAAAGG - Intronic
1075905373 10:126076681-126076703 TTCAATTTAAAAATGGGCAAAGG - Intronic
1076237210 10:128872573-128872595 CTGAGCTAAAAAATAAACAATGG + Intergenic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1076556572 10:131326335-131326357 CTGAACTGTAAAAAGAACAACGG + Intergenic
1077181022 11:1216516-1216538 CCCAACTAAAAAATTGACAAAGG + Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1078042032 11:7875511-7875533 CACAATTTAAAAATGGGCAAAGG + Intergenic
1078071689 11:8116579-8116601 CCCAATTTAAAAATGGGCAAAGG + Intronic
1078116863 11:8462111-8462133 TGTAACTTAAAATTGGACAAAGG - Intronic
1078411441 11:11123237-11123259 CAGAACATAAAAATGTACTATGG + Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079621724 11:22563909-22563931 CTGGACATAGGAATGGACAAAGG - Intergenic
1079663840 11:23078261-23078283 TTGAAAGTAAAAATGGAGAAAGG + Intergenic
1080191102 11:29550209-29550231 CTCCAATTAAAAATGGGCAAAGG - Intergenic
1080286139 11:30615013-30615035 CCTGACTTAAAAATGGGCAAAGG - Intergenic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1081055352 11:38403566-38403588 CCCTATTTAAAAATGGACAAAGG - Intergenic
1081166848 11:39818360-39818382 CTGAAGTGAAGAAGGGACAAAGG - Intergenic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1081951500 11:47047827-47047849 CCCAATTTAAAAATGGGCAAAGG + Intronic
1082633844 11:55572576-55572598 CTGAACTAAAGAATGCACACAGG - Exonic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1084986097 11:72873411-72873433 CTCAACTTAAAAATGGGAAAAGG - Intronic
1085033971 11:73289237-73289259 CTGAACTGAAAAAAGGAAACTGG + Intronic
1085343208 11:75747332-75747354 CCTAATTAAAAAATGGACAAAGG + Intergenic
1085377320 11:76076777-76076799 CCTAATTTAAAAATGGTCAAAGG - Intronic
1085557070 11:77433807-77433829 ACCAATTTAAAAATGGACAAAGG + Intronic
1085581541 11:77655239-77655261 CTGATCATAAAAATAGGCAAAGG + Intergenic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086144031 11:83531324-83531346 CCCAATTTAAAAATGGGCAAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087231455 11:95670387-95670409 CACAATTTTAAAATGGACAAAGG - Intergenic
1087413615 11:97824230-97824252 GCCAACTTAAAAATGGACAAAGG - Intergenic
1087611600 11:100441059-100441081 CTCAATTTAAAAATGAGCAAAGG + Intergenic
1087782492 11:102316203-102316225 GTTAAGTTAAAAATGGGCAAGGG + Intergenic
1088155163 11:106793671-106793693 CCCAATTTAAAAATGAACAAAGG + Intronic
1088244861 11:107807874-107807896 CTGAACTTAAAGATATACACAGG - Intronic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088418471 11:109616515-109616537 CTCATTTTAAAAATGGGCAAAGG + Intergenic
1089168556 11:116496865-116496887 CTGGATTTAAAAATTGGCAAAGG - Intergenic
1089766183 11:120767369-120767391 CCCAATTTAAAAATGGGCAAAGG - Intronic
1089851684 11:121502710-121502732 CCCAATTTAAAAACGGACAAAGG - Intronic
1089918204 11:122180422-122180444 GAGAACTTAAAAAAGGAAAAAGG + Intergenic
1091163426 11:133447864-133447886 CTCAACTTAAAAATAAGCAAAGG - Intronic
1091304234 11:134527179-134527201 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091503969 12:1048014-1048036 CAAAACTTCAAAATGAACAAAGG - Intronic
1091559227 12:1598314-1598336 CCCAATTTAAAAATGGGCAAAGG + Intronic
1091892938 12:4075756-4075778 CAGAAATTAAAAATGCAAAATGG - Intergenic
1092104949 12:5914689-5914711 CTGAAATTGGAAATGGAGAATGG - Intronic
1092246892 12:6868698-6868720 CTGGGCTGGAAAATGGACAAAGG + Intronic
1092632682 12:10399929-10399951 CCCTATTTAAAAATGGACAAAGG + Intronic
1093044190 12:14423202-14423224 CCCAATTTAAAAATGGTCAAAGG - Intronic
1093112850 12:15172802-15172824 ACCAAATTAAAAATGGACAAGGG - Intronic
1093188177 12:16045703-16045725 CAGAACTTGTAAATGGACAGCGG + Intergenic
1093374010 12:18401680-18401702 CCCAACTGTAAAATGGACAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093531322 12:20167970-20167992 TTGAAGTACAAAATGGACAATGG - Intergenic
1093587084 12:20851489-20851511 TGCAACTAAAAAATGGACAAAGG - Intronic
1093855517 12:24097203-24097225 TCCAATTTAAAAATGGACAAAGG - Intergenic
1093956595 12:25227498-25227520 TTCAATTTAAAAATGGGCAAAGG + Intronic
1094099593 12:26747360-26747382 CTACTCTTCAAAATGGACAATGG - Intronic
1094457548 12:30654536-30654558 CCCAACTTAAAAATGGGCAAAGG + Intronic
1094584401 12:31764537-31764559 CCCAACTAAAAAATTGACAAAGG + Intergenic
1094632987 12:32195961-32195983 CCCAATTTAAAAACGGACAAAGG + Intronic
1095254874 12:40022929-40022951 AGGAACTTAAAAATGGTCATGGG - Intronic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095484899 12:42674561-42674583 CTGAACTTGAAAACGGGCAGTGG - Intergenic
1095641691 12:44493382-44493404 ATGAACATCAAAATGGACTAAGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1096236938 12:49935339-49935361 CTCAATTTAAAAAGGGGCAAAGG - Intergenic
1096356709 12:50947437-50947459 CTGACTTTAAAAATGGAGGAAGG - Intergenic
1096762915 12:53858367-53858389 CCCAATTTAAAAATGGACTAAGG + Intergenic
1097311515 12:58124037-58124059 ATGACTTTAAAAATGGGCAATGG + Intergenic
1097609522 12:61801930-61801952 ACCAACTTAAAAATGGGCAAAGG + Intronic
1097652429 12:62318112-62318134 CTGAAGTTGAGAATGGTCAAAGG - Intronic
1097660993 12:62431168-62431190 CACAATTTAAAAATGGGCAAAGG + Intergenic
1097856162 12:64464761-64464783 CCCAATTTAAAAATGGGCAAAGG + Intronic
1098186962 12:67906899-67906921 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1098325333 12:69296431-69296453 CTTAAGTTAAAAATGGGCAAAGG + Intergenic
1098530119 12:71532198-71532220 GTGAACTTAAAATTGGATGATGG + Intronic
1098969396 12:76834084-76834106 ATGAAGTTTAAAATGCACAAAGG + Intronic
1099045805 12:77717898-77717920 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1099258874 12:80350726-80350748 CCCAATTTAAAAATGGTCAAAGG - Intronic
1099259665 12:80361800-80361822 CTGATTTTTAAAATGGGCAAAGG - Intronic
1099381914 12:81965016-81965038 CTAAACTAAAAAATAAACAAAGG - Intergenic
1099688344 12:85918618-85918640 CCCAATTCAAAAATGGACAAAGG - Intergenic
1100423906 12:94464149-94464171 TCCAATTTAAAAATGGACAAAGG + Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1100462187 12:94810846-94810868 CCCAACTTAAAAATGGGCAAAGG + Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1101482488 12:105112726-105112748 CCCAATTTAAAAATGGGCAAAGG - Intronic
1101677586 12:106932273-106932295 ATTAAGTTAAAAATGGATAAAGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102366532 12:112341333-112341355 CTGATCTTAAAAAAGGTGAAGGG - Intronic
1103364486 12:120371237-120371259 CTGAACTTAAAAAGGGTCATTGG + Intergenic
1103608007 12:122102257-122102279 CCCAATTTAAAAATGGACAGAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105772300 13:23623800-23623822 CCTAATTTAAAAATGGGCAAGGG - Intronic
1105823615 13:24102302-24102324 CCCAATTTAAAAATGGATAAAGG - Intronic
1105998944 13:25701018-25701040 TCCAACTTAAAAATGGGCAAAGG - Intronic
1106057563 13:26253198-26253220 CAAAAATTAAAAATAGACAAGGG + Intergenic
1106100604 13:26692606-26692628 ATGAACATAAAAATGGAGACTGG - Intergenic
1106105047 13:26725510-26725532 CTCAGTTTAAAAATGGGCAAAGG - Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106738544 13:32613561-32613583 CCCAATTTAAAAATGGGCAAAGG - Intronic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107233526 13:38140002-38140024 AATAACTTAAAAATGGGCAAAGG - Intergenic
1107447614 13:40482547-40482569 CACAACTTAAAAATGGAAGAAGG + Intergenic
1107519491 13:41165021-41165043 CCCAACTTAAAAATGGGCAAAGG - Intergenic
1107593140 13:41930049-41930071 CCCAATTTAAAAATGGGCAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108680391 13:52775124-52775146 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1109015530 13:57007712-57007734 CTGATTTTTAAAATGGGCAAAGG + Intergenic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109280844 13:60353294-60353316 CCCAATTTAAAAATGAACAAAGG - Intergenic
1109301221 13:60592148-60592170 CTTAACTTAAAATAGGCCAAGGG + Intergenic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109643186 13:65218718-65218740 ATGAAGTTGAAGATGGACAATGG + Intergenic
1109644335 13:65233841-65233863 TTCAATTTAAAAGTGGACAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1111162954 13:84419897-84419919 CTGAACCTAAAATAGGCCAAGGG + Intergenic
1112111003 13:96298924-96298946 CTGAACTTACAAATTTAAAAAGG - Intronic
1112472701 13:99703251-99703273 TTAAATTTAAAAAGGGACAATGG - Intronic
1112585323 13:100714021-100714043 TAAAACTTAAAAATGGATAATGG - Intergenic
1112586849 13:100726182-100726204 GCCAACTTAAAAATGTACAATGG - Intergenic
1112815819 13:103271931-103271953 AATAACTTAAAAATGGGCAAAGG + Intergenic
1112823203 13:103359725-103359747 CCTAATTTAAAAATGAACAATGG + Intergenic
1112856540 13:103777066-103777088 CCTAAGTTAAAAATGGGCAAAGG - Intergenic
1113282358 13:108802894-108802916 CCCAATTTAAAAATGGCCAAAGG - Intronic
1113571979 13:111364522-111364544 CCAAATTTAAAAATTGACAAAGG + Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1113859113 13:113469638-113469660 CTGCACTTAAACCTGGGCAACGG + Intronic
1114362326 14:21988295-21988317 CTGATCTTAGAAATCAACAAGGG + Intergenic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114375961 14:22147388-22147410 GTGAATTTAAAAATGTAAAATGG - Intergenic
1114940671 14:27606603-27606625 CTGAACTCCAAAAGGGAGAAGGG - Intergenic
1115003520 14:28451381-28451403 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115582434 14:34774844-34774866 CCCAATTTAAAAATGGGCAAAGG + Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116104332 14:40480872-40480894 CTGAATTTAAGAATGGCCAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1117128501 14:52659212-52659234 ATGAATTTAAAAATTCACAAAGG + Intronic
1117443085 14:55778188-55778210 GTAAACTTAAAAATGGTTAATGG - Intergenic
1117464362 14:55977433-55977455 CTGTGCTTAAAAATGGACAGAGG - Intergenic
1117934344 14:60885579-60885601 CTCAACTTAAAAATGGGCAAAGG - Intronic
1118120335 14:62832939-62832961 CCAAATTTAAAAATGGGCAAAGG - Intronic
1118214102 14:63791961-63791983 CAAAACTTAAAAATGAACAAAGG + Intergenic
1118312059 14:64701362-64701384 CCCAGTTTAAAAATGGACAAAGG - Intergenic
1118628657 14:67682425-67682447 TCCAACTTAAAAATGGGCAAAGG + Intronic
1118986773 14:70762570-70762592 CTTACTTTAAAAATGGGCAAAGG - Intronic
1119478356 14:74944878-74944900 GTCAACTTAAGAATGGGCAAGGG + Intronic
1119960583 14:78851335-78851357 CTGAACTTGAAATTGGGCAGAGG + Intronic
1120061496 14:79988719-79988741 CTGAGCTTGAAGATGGAGAAAGG - Intergenic
1120094342 14:80371127-80371149 CCCAACTAAAAAATGGGCAAAGG - Intronic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120196043 14:81483737-81483759 GCCAACTTAAAAATGTACAAGGG + Intronic
1120277896 14:82400484-82400506 CTCCATTTAAAAGTGGACAAAGG - Intergenic
1120374588 14:83686446-83686468 CCAGATTTAAAAATGGACAAAGG + Intergenic
1120611864 14:86651415-86651437 TCAAACTTAAAAATGGGCAAAGG + Intergenic
1120729523 14:87986941-87986963 CAGAACTTAAAGTTGGACATGGG - Intronic
1120891790 14:89498079-89498101 CCTAACTCAAAAATGGGCAAAGG - Intronic
1120931860 14:89856756-89856778 CCCAATTTAAAAATGGGCAAAGG - Intronic
1121316903 14:92967248-92967270 CTCTATTTAAAAATGGGCAAAGG + Intronic
1121657624 14:95609223-95609245 CTCAATTTAAAAATGGGCTAAGG - Intergenic
1121663891 14:95657404-95657426 CTGATCTTAAAAAGAAACAATGG - Intergenic
1121832607 14:97065223-97065245 ATGAACTTAAACATGCACAGAGG + Intergenic
1121975516 14:98400213-98400235 CTAATTTTAAAAATGGGCAAAGG + Intergenic
1122617176 14:103026999-103027021 CCCAATTTAAAAATGGGCAAAGG + Intronic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1124056758 15:26247457-26247479 CTCAATTTAAAAATTAACAAAGG - Intergenic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124654711 15:31498947-31498969 CTGAACTTGAAGATGGTCAGTGG + Intronic
1124821414 15:33049611-33049633 CTGAACTTAAATATGTAAGAAGG - Intronic
1124843476 15:33266685-33266707 CGTGACTAAAAAATGGACAAAGG - Intergenic
1124850211 15:33329709-33329731 CTGTTCTTAAAATTTGACAAAGG + Intronic
1125318701 15:38459195-38459217 CTGGGCTTAAAGATGCACAAGGG + Intronic
1125554819 15:40575456-40575478 CCCAACTTAAAAATGGGCAAAGG + Intergenic
1126019449 15:44385858-44385880 CCCAACATAAAAATGGGCAAAGG - Intronic
1126378368 15:48019640-48019662 CCAAATTTTAAAATGGACAAAGG + Intergenic
1126895704 15:53254967-53254989 CTAAGCTTAAAAATGGAAATTGG + Intergenic
1127209269 15:56756089-56756111 CCCAACTTAAAAATGGGCATAGG + Intronic
1127229928 15:56980043-56980065 CTTGACTTATAAATGAACAATGG - Intronic
1127309001 15:57735329-57735351 CTGAAGTATAATATGGACAAAGG - Intronic
1127732454 15:61813427-61813449 TTGAACTTTAAAGTGGACACTGG + Intergenic
1128658470 15:69479966-69479988 CCCAATTTAAAAATGGGCAATGG + Intergenic
1129237358 15:74231713-74231735 CTCACCTTAAAAATGGACTCTGG + Intergenic
1129355533 15:74988320-74988342 ATCCACTTAAAAATGCACAAAGG - Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130718286 15:86358844-86358866 CTTAATTTAAAAATGGGCTAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131010601 15:89014993-89015015 CCGAATTTTAAAATGGGCAAAGG + Intergenic
1131527405 15:93163594-93163616 TTGACCTTCAAAATGGACAGAGG + Intergenic
1131812987 15:96192380-96192402 ATGTAATTAAAAATGGGCAAAGG - Intergenic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1132168640 15:99623716-99623738 CCCAATTTAAAAATGGGCAAAGG - Intronic
1132199329 15:99938267-99938289 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1132222775 15:100117302-100117324 CTGAACTTAAAATTTGGCCATGG + Intronic
1132990968 16:2793579-2793601 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1133945917 16:10348421-10348443 CTGCACTCCAAACTGGACAATGG - Intronic
1134424772 16:14130152-14130174 CCCAATTTAAAAATGGGCAAAGG - Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135839815 16:25865483-25865505 CTGATTTTTAAAATGGGCAAAGG - Intronic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1137248384 16:46724126-46724148 CCCAATTTAAAAATGGTCAAAGG - Intronic
1137258159 16:46795440-46795462 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1137287456 16:47027969-47027991 CTTAACTTAAAAAAAGAAAAAGG - Intergenic
1137517033 16:49154804-49154826 ATTAATTTAAAAATGGACAGAGG + Intergenic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1138291483 16:55851310-55851332 CTCAATTCAAAAATGGGCAAGGG + Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138334653 16:56243486-56243508 CCTAACTTAAAAATGGGCAAAGG + Intronic
1138486367 16:57347260-57347282 CACAACTGAAAAATGGAAAATGG + Intergenic
1138636589 16:58344032-58344054 CCAGATTTAAAAATGGACAAAGG - Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138792350 16:59920751-59920773 CTGAACATAAAAACAGGCAATGG - Intergenic
1138900970 16:61269592-61269614 CTCAACTAAAAAATGAACAATGG - Intergenic
1139019393 16:62728630-62728652 CTAAAATAAGAAATGGACAAGGG - Intergenic
1139190954 16:64862256-64862278 CTGAACTCATAAATGGATTATGG - Intergenic
1139812349 16:69631884-69631906 ATGAACTTAAAAACCGACAGTGG - Intronic
1140097532 16:71887829-71887851 CTCAATTTAAAAATAGGCAAAGG - Intronic
1140223583 16:73061467-73061489 CTGAAGGTAAAAATATACAATGG - Intergenic
1140635732 16:76911009-76911031 CTTAGCCTAAATATGGACAAGGG - Intergenic
1140716519 16:77730910-77730932 AAAAATTTAAAAATGGACAAAGG - Intronic
1140949122 16:79798781-79798803 CTGAAGTTAAGAAAGGAAAAAGG + Intergenic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1142892729 17:2955448-2955470 CTCAATTTAAAAACGGGCAAAGG - Intronic
1143739191 17:8940330-8940352 CTGAACTTCATAATGTACCACGG - Intronic
1143786277 17:9258083-9258105 CTAAACTTAAAGATGAACAGAGG + Intronic
1143967978 17:10770573-10770595 GTGAACTTAAAAATTGTCACTGG + Intergenic
1144158150 17:12528426-12528448 CTGAAGTTAATCATGGACTAGGG - Intergenic
1144597112 17:16579671-16579693 AAAAACTTAAAAATGGGCAAAGG - Intergenic
1144962674 17:19054738-19054760 CACAATTTAAAAATGGGCAAAGG + Intergenic
1144972487 17:19119783-19119805 CACAATTTAAAAATGGGCAAAGG - Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1146117174 17:30151186-30151208 ACAAACTAAAAAATGGACAAAGG - Intronic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1146866691 17:36342267-36342289 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1147069559 17:37942876-37942898 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147081089 17:38022414-38022436 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147097031 17:38146371-38146393 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147272514 17:39285569-39285591 ATGTACTGAAAAATGGAAAAAGG + Exonic
1148766491 17:50042097-50042119 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1149663423 17:58348903-58348925 CTGAAGTCAAAAATGAGCAAAGG + Intronic
1149889850 17:60378115-60378137 CTCAATTCAAAAATGGGCAAAGG + Intronic
1150012712 17:61520728-61520750 CTCAATTTAAAAATGGGAAAAGG - Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150088846 17:62301685-62301707 CTCCACTTAAAAGTGGGCAAAGG - Intergenic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151885802 17:76922784-76922806 ATAAACTTAAAAATGGCCAAGGG - Intronic
1152226913 17:79097006-79097028 CTGACCTCAAGAGTGGACAACGG + Intronic
1152493360 17:80653055-80653077 CCCAACTAAAAAATGGACAAAGG - Intronic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1153206581 18:2709738-2709760 CAAAATTTAAAAATGGCCAAAGG - Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153385335 18:4487821-4487843 CACAACTTAAAAATGGGTAAAGG + Intergenic
1153595694 18:6722967-6722989 CAAAACTTTAACATGGACAAAGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153853397 18:9119110-9119132 CAGAATTTAAAAATTTACAAAGG - Intronic
1153883327 18:9439487-9439509 CCCAATTTAAAAATGGTCAAAGG + Intergenic
1154137557 18:11793621-11793643 AATAATTTAAAAATGGACAAAGG + Intronic
1154968001 18:21378843-21378865 ATTAATTTAAAAATGGGCAATGG - Intronic
1155265766 18:24091785-24091807 GCCAATTTAAAAATGGACAATGG + Intronic
1155417095 18:25610751-25610773 CCTGACTTAAAAATGGGCAAAGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155874656 18:31070894-31070916 ATGAAGTTATAAATGTACAATGG + Intronic
1156300890 18:35834978-35835000 CTGATGTTAAAACTGGACATAGG + Intergenic
1156560012 18:38114071-38114093 CTTAAATACAAAATGGACAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157226001 18:45865391-45865413 CTGACCTTTAAGCTGGACAATGG - Intronic
1157320949 18:46633788-46633810 CTTAATTTAAAAATGGATGAAGG + Intronic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158063416 18:53375948-53375970 CTGAACTTAAAAAGGCACTCGGG + Intronic
1158290721 18:55938932-55938954 CAGGAATGAAAAATGGACAAGGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159340779 18:67129904-67129926 GCAAACATAAAAATGGACAATGG - Intergenic
1159578941 18:70213101-70213123 CTCAATTTTAAAATGGGCAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160197511 18:76768421-76768443 CTCAACTAAAAAATGGGCAAAGG - Intergenic
1160611744 18:80093804-80093826 CCCAATTTAAAAATGGGCAAAGG + Intronic
1161753197 19:6112334-6112356 CTGATCTGAAAAATGGGGAAAGG - Intronic
1161775165 19:6257497-6257519 CCTAATTCAAAAATGGACAACGG + Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1163537742 19:17887106-17887128 CCCAATTTAAAAATGGGCAAAGG - Intronic
1163732469 19:18957466-18957488 CTGAACTCAAGAATGTACACTGG - Intergenic
1166265473 19:41681087-41681109 CCCAATTTAAAAATGGGCAAAGG + Intronic
1166456699 19:42947534-42947556 CCCAATTAAAAAATGGACAAAGG + Intronic
1166466656 19:43038400-43038422 CCCAATTAAAAAATGGACAAAGG + Intronic
1166493563 19:43281457-43281479 CCCAATTAAAAAATGGACAAAGG + Intergenic
1167427244 19:49435759-49435781 CTGAAATTAAAATAGGAGAAAGG + Intronic
1167704764 19:51074689-51074711 CCCAATTAAAAAATGGACAAAGG + Intergenic
1167724970 19:51205074-51205096 CCCAACTTTAAAATGGACAAAGG + Intergenic
1167726897 19:51221084-51221106 CAACACTTAAAAATGGACAGAGG + Intergenic
1168391708 19:56013972-56013994 ATGAAGTTAAAAAAGGACCAAGG - Intronic
926528788 2:14015528-14015550 CCCAATTTAAAAATGGGCAAAGG - Intergenic
926805138 2:16702069-16702091 GTGCATTTAAAAATGCACAATGG + Intergenic
927359185 2:22211944-22211966 CTGATTTTAAAAATAGGCAAAGG - Intergenic
927405777 2:22764876-22764898 CTCATCTAAAAAATGGGCAAAGG - Intergenic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
927829880 2:26340517-26340539 CTGAAATTAAAAAAGAACAGTGG + Intronic
927906970 2:26865611-26865633 ATGCATTTAAAAATGGACACAGG - Intronic
928171428 2:29007043-29007065 CAGAACTTAGAAATGGAAGAGGG - Intronic
928237053 2:29552676-29552698 CCCAACTAAAAAATGGGCAAGGG - Intronic
928861308 2:35860624-35860646 TTGAACTTGAAAAGGGACTAAGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929181202 2:39041380-39041402 CCCAATTTAAAAATGGGCAAAGG - Intronic
929496843 2:42452066-42452088 CCCAACTAAAAAATGGACAAAGG + Intronic
929605253 2:43229633-43229655 CTGAAATTATAAATGAAAAATGG + Intergenic
930138756 2:47930240-47930262 CTCAATTTAAAAATAGGCAAAGG + Intergenic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
930396119 2:50826718-50826740 ATGAACTAGAAAATGGAGAATGG + Intronic
930589430 2:53309722-53309744 CCCAATTAAAAAATGGACAAAGG + Intergenic
931043408 2:58323476-58323498 CCAAACTTAAAATTGTACAAAGG - Intergenic
931136502 2:59408163-59408185 AAGATTTTAAAAATGGACAAGGG + Intergenic
931258306 2:60594602-60594624 CTGAACTAAGAAATGGCAAAAGG - Intergenic
931519105 2:63075581-63075603 CTGACTTTTAAAATGGACACAGG - Intergenic
931552691 2:63464182-63464204 TCCAACTTAAAAATGGGCAAAGG + Intronic
932035023 2:68236009-68236031 CTCAATTTAAAAGTGGGCAAAGG - Intronic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932341911 2:70968351-70968373 CCCAACTTTAAAATGGGCAAAGG - Intronic
932671466 2:73741112-73741134 CTGCACTCCAACATGGACAATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
933288945 2:80415087-80415109 ATAAACTTCAAAATGTACAAAGG + Intronic
933440609 2:82308809-82308831 ATCAAATTAAAAATGGGCAAAGG + Intergenic
933525137 2:83427898-83427920 CTGATTTTAAAAATGAGCAAAGG + Intergenic
933819995 2:86102446-86102468 TTCAATTTTAAAATGGACAAAGG - Intronic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
934953681 2:98598310-98598332 CCGAACTGAAAACTGGACTAAGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935258805 2:101336757-101336779 GTGAATTTTAAAATGTACAAGGG - Intergenic
935470377 2:103452481-103452503 CAGAACTTAGTAATGGATAATGG - Intergenic
935800807 2:106693677-106693699 CTCTATTTAAAAATGGTCAAAGG - Intergenic
935938293 2:108210217-108210239 CCCTAATTAAAAATGGACAAAGG - Intergenic
935946520 2:108291304-108291326 GGGCACTTAAAAGTGGACAAGGG - Intronic
936386719 2:112036798-112036820 CTCAATTTAAAAATAGGCAAAGG + Intergenic
937039771 2:118812293-118812315 CCGAACAGAAAAATTGACAAAGG - Intergenic
937184436 2:120026876-120026898 CCCAATTTAAAAATGGGCAAAGG + Intronic
937273999 2:120672658-120672680 GTGCACTTAAAAATGGTTAATGG - Intergenic
937510023 2:122584841-122584863 ACCAAATTAAAAATGGACAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938148139 2:128855329-128855351 CCCAATTTAAAAATGGGCAAAGG - Intergenic
938166375 2:129030694-129030716 CCCAATTTAAAAATGGGCAAAGG + Intergenic
938235596 2:129703952-129703974 CTGGACTTAAAAATAGGCAAAGG - Intergenic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
938955814 2:136297135-136297157 CTGATTTTTAAAATGGGCAAAGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939149088 2:138451920-138451942 CTCTATTTAAAAATGGGCAAAGG - Intergenic
939212040 2:139188086-139188108 TCCAATTTAAAAATGGACAAAGG - Intergenic
939490613 2:142871791-142871813 ATGAACCTAAAATTGCACAATGG + Intergenic
939809723 2:146815928-146815950 CCCAATTTAAAAATGAACAAAGG - Intergenic
940103287 2:150067747-150067769 CCCAATTTAAAAATGAACAAAGG - Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940304463 2:152211038-152211060 TCCAATTTAAAAATGGACAAAGG - Intergenic
940556801 2:155239119-155239141 TTGAAATTGAAAATGGACACAGG + Intergenic
940665481 2:156603400-156603422 CCCAATTTAAAAATGGGCAAAGG - Intronic
940977613 2:159963557-159963579 TCCAATTTAAAAATGGACAAAGG + Intronic
940981516 2:160008867-160008889 CCCAATTAAAAAATGGACAAAGG + Intronic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941385545 2:164846304-164846326 CTGAAGTTAGAAATACACAAAGG + Intergenic
941501046 2:166276624-166276646 ATGAAGTTAATAATGGACCAAGG - Intronic
941589666 2:167403861-167403883 CTGATCTTGAAAAGGGACTAGGG + Intergenic
941618415 2:167750024-167750046 CTAAAATTTAAAATGGCCAAAGG - Intergenic
941779508 2:169428733-169428755 CCAAATTTAAAAATGGGCAAAGG + Intergenic
942055360 2:172177276-172177298 CCTAATTTAAAAATGGGCAAAGG - Intergenic
942217332 2:173734273-173734295 CCTAACTAAAAAATGGACAAAGG - Intergenic
942359343 2:175155911-175155933 ATCAACTTTAAAATGTACAAGGG + Intronic
942402505 2:175618059-175618081 CCAATTTTAAAAATGGACAAAGG - Intergenic
942507552 2:176659466-176659488 GTGAACTTACATATGGAGAAAGG + Intergenic
942674178 2:178410271-178410293 CTTTATTTAAAAATGGGCAAAGG + Intergenic
943006070 2:182389420-182389442 CCCAATTAAAAAATGGACAAAGG + Intronic
943221765 2:185118751-185118773 CTGAACTAAAACATGAACATAGG + Intergenic
943365623 2:186964908-186964930 CTGAACTGAAAAGTGAACACAGG - Intergenic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
944158188 2:196631308-196631330 CCCAATTTAAAAATGGGCAAAGG + Intergenic
944291583 2:198013210-198013232 ATGAACTTAAAAATGACCAATGG - Intronic
944390505 2:199213830-199213852 CCCAATTTAAAAATGGGCAAAGG + Intergenic
944521757 2:200577351-200577373 CCCAACTGAAAAATGGGCAAAGG - Intronic
945215251 2:207426879-207426901 CCCAATTTAAAAATGGGCAAAGG + Intergenic
945324508 2:208466687-208466709 CCCAATTTAAAAATGGGCAAAGG - Intronic
945379786 2:209126753-209126775 CTGATTTTAAAAATGGGTAAAGG - Intergenic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
945689657 2:213017678-213017700 GTGAACTAATAAATGGAGAAGGG - Intronic
945819342 2:214644606-214644628 CTCAATTGAAAAATGGGCAAAGG - Intergenic
946512043 2:220368481-220368503 CTGATTTTTAAAATGGGCAAAGG + Intergenic
946636918 2:221739558-221739580 ATAATTTTAAAAATGGACAAAGG + Intergenic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
947311133 2:228803747-228803769 CTCAAGTTAAAAATGGGCAAAGG - Intergenic
947330929 2:229028597-229028619 CCCAACTTAAAAATGGGCAAAGG + Intronic
947468397 2:230375720-230375742 CCTAATTTAAAAATGGGCAAAGG - Intronic
948769387 2:240241205-240241227 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1168867490 20:1100353-1100375 CCCAATTTAAAAATGGACCAAGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169309572 20:4523601-4523623 ACCAACTTAAAAATGGGCAAAGG + Intergenic
1169334541 20:4744916-4744938 CTGATTTTAAAAATTGGCAAAGG + Intergenic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1170190094 20:13637066-13637088 TTCAATTTAAAAATGGGCAAAGG + Intronic
1170258914 20:14380273-14380295 CCCAACTAAAAAATGGGCAAAGG - Intronic
1170631426 20:18069839-18069861 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1170657578 20:18304074-18304096 CCCAGCTTAAAAATGGACAAAGG + Intronic
1170773805 20:19357985-19358007 CTGAACTGAAAAGTGGTAAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171378346 20:24711477-24711499 CTCATTTTAAAAATGGGCAAAGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1172907964 20:38383311-38383333 CGGAACTTCACAATGCACAAAGG + Intergenic
1173015062 20:39217684-39217706 ATAAATTTAAAAATGGATAAAGG - Intergenic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1174345338 20:49925026-49925048 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1174345456 20:49925799-49925821 ATAAAATTAAAAATGGGCAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176363025 21:6014444-6014466 CCCAACTCAAAAATGGGCAAAGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176725907 21:10432315-10432337 CTCAATTTCAAAATGGGCAAAGG - Intergenic
1176740900 21:10600996-10601018 CTGAATTTAAAAAATAACAACGG - Intronic
1177338639 21:19767511-19767533 ATAAAATAAAAAATGGACAAAGG - Intergenic
1177397339 21:20554220-20554242 CTGAACTGAAAAAATGACATTGG + Intergenic
1177520989 21:22225394-22225416 CTGAACTTAAATATGTAAAGAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177836279 21:26189379-26189401 CTGAACTTAAAAGTTGAAGAAGG - Intergenic
1177841774 21:26242455-26242477 CCTGATTTAAAAATGGACAAAGG - Intergenic
1177931421 21:27288725-27288747 TTTCACTTAAAAATGGACTAAGG + Intergenic
1177932454 21:27301848-27301870 CTCAACCTAAAAGTGGTCAAAGG + Intergenic
1178183681 21:30194213-30194235 CTGGACATATAAGTGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179066927 21:38033738-38033760 CTAATTTTAAAAATGGGCAAAGG - Intronic
1179085165 21:38209899-38209921 CAAAATTTAAATATGGACAATGG + Intronic
1179120181 21:38537494-38537516 CCCAATTTAAAAATGGGCAAAGG + Intronic
1179130217 21:38629462-38629484 CCCAACTCAAAAATGGGCAAAGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179760493 21:43524101-43524123 CCCAACTCAAAAATGGGCAAAGG + Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180939986 22:19654401-19654423 CACAATTTAAAAATGTACAAAGG + Intergenic
1181101114 22:20539894-20539916 CCCAATTTAAAAATGGACAGAGG - Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1183155069 22:36068539-36068561 ATCAATTTAAAAATGGGCAAAGG + Intergenic
1183611472 22:38909829-38909851 CCTAATTTAAAAATGGGCAAAGG - Intergenic
1183790363 22:40062783-40062805 CCCAATTTAAAAATGGGCAAAGG - Intronic
1184475501 22:44718819-44718841 CCCAACTGAAAAATGGGCAAGGG - Intronic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
1185363836 22:50425848-50425870 CTCAATTCAAAAATGGTCAAAGG - Intronic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949709499 3:6858500-6858522 CTGAAATTAAAAATGAAATAAGG + Intronic
949921343 3:9005109-9005131 CCAAATTTAAAAATGGGCAAAGG + Intronic
950059391 3:10057155-10057177 CCTAATTTAAAAATGGGCAAAGG - Intronic
950145161 3:10644093-10644115 CCCAATTTAAAAATGGGCAAAGG + Intronic
950519578 3:13489080-13489102 CCAATTTTAAAAATGGACAAAGG - Intronic
950607748 3:14098212-14098234 CCTGACTTAAAAATGGGCAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951335285 3:21413714-21413736 TTGAAATTAAAAATAGACTATGG - Intergenic
951561576 3:23972272-23972294 CAGTAATTAAAAATGGACATTGG - Intronic
951703220 3:25517311-25517333 CTCAATTTTAAAATGGGCAATGG + Intronic
951936339 3:28026884-28026906 CTCAATTTAAAAATGGGTAAAGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
951988920 3:28653715-28653737 CCCAATTTAAAAATGGGCAAAGG - Intergenic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952363066 3:32650375-32650397 CCCAATTTAAAAATTGACAAAGG - Intergenic
952433933 3:33253378-33253400 CTCAACTTAAAAATAGGCAAAGG - Intergenic
952554113 3:34512390-34512412 CTGAACTTCAGAAGTGACAATGG - Intergenic
952804888 3:37339708-37339730 TCCAACTAAAAAATGGACAAAGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953204240 3:40807673-40807695 CCCAATTTAAAAAGGGACAAAGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953379938 3:42462225-42462247 CTGAGCTTAAACATGGAAATTGG - Intergenic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
954376881 3:50199409-50199431 CTCAATTCAAAAATGGGCAAAGG - Intergenic
954643086 3:52113969-52113991 ATGAAATGAAAAATGCACAAAGG + Intronic
954741677 3:52756918-52756940 CCCAACTCAAAAATGGGCAAAGG + Intronic
954932059 3:54292491-54292513 CACAATTTAAAAATGAACAAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956183144 3:66535908-66535930 CTGAACCTAAAATAAGACAAAGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956393213 3:68796803-68796825 CCCAATTTAAAAATGGCCAAAGG + Intronic
956565609 3:70634320-70634342 CCCAAGTTAAAAATGGGCAAAGG + Intergenic
956677238 3:71747449-71747471 CCAATTTTAAAAATGGACAAAGG - Intronic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
956966646 3:74469518-74469540 CCCAATTTAAAAATGGGCAAAGG + Intronic
957605520 3:82393712-82393734 CTTAATTTAAAAATGGGAAAAGG - Intergenic
957993800 3:87662103-87662125 CACAATTTAAAAATGGGCAAAGG + Intergenic
958033955 3:88149046-88149068 TAGGACTTAAAAATGGAAAAAGG + Intronic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
958947148 3:100376211-100376233 CCTAAGTTAAAAATGGGCAAAGG - Intronic
959167114 3:102794038-102794060 CTGATCTTGAAAATGGAGAAAGG + Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959839486 3:110958212-110958234 CTGAAGTGAAAACTGTACAAAGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960059243 3:113302902-113302924 TAGAAATCAAAAATGGACAAAGG + Intronic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960597984 3:119424152-119424174 CTGAATTAAAAAATAGGCAAGGG - Intergenic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961408526 3:126701092-126701114 CCCAATTTAAAAATGGGCAAAGG - Intergenic
961418295 3:126778586-126778608 ATCCAATTAAAAATGGACAAAGG - Intronic
961624354 3:128250072-128250094 CCCAACCTAAAAATGTACAAAGG - Intronic
961967432 3:130920012-130920034 CTCAACTTAAAAATGTGCTAAGG - Intronic
962047884 3:131779998-131780020 CTGCATTAAAAAATGGGCAAAGG + Intronic
962275124 3:134007148-134007170 CCGAATTTAAAAATTGGCAAAGG - Intronic
962819180 3:139030880-139030902 CCCAACTAAAAAATGGACAAAGG - Intronic
962912628 3:139867753-139867775 CACAATTTAAAAATGGGCAAAGG + Intergenic
963007910 3:140743170-140743192 CTGATTTTAAGAAGGGACAAAGG + Intergenic
963142219 3:141956278-141956300 CTCTACTTAAAAATGAGCAAAGG + Intronic
963144889 3:141983333-141983355 CTCAATTCAAAAATGGGCAAAGG + Intronic
963172327 3:142263502-142263524 CCTAATTTAAAAATAGACAAAGG - Intergenic
963272216 3:143296852-143296874 CCCAATTTAAAAATGGGCAAAGG - Intronic
963389809 3:144646663-144646685 CTCAATTTAAAAATGAGCAAAGG - Intergenic
963621843 3:147619105-147619127 CTGAGTTTCAAAATTGACAAGGG + Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
963812473 3:149792202-149792224 GTGCATTTAAAAATGTACAAAGG - Intronic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964199902 3:154107469-154107491 CCCAACATAAAAATGCACAAAGG + Intergenic
964451890 3:156821302-156821324 GTGAGCTTAAAACTGTACAAAGG - Intergenic
965278256 3:166716031-166716053 CTGAGCTTAAATATGTACAGAGG + Intergenic
965318200 3:167217046-167217068 CTGGACCTAAGAATGGGCAAAGG + Intergenic
965655818 3:170983564-170983586 CCCGATTTAAAAATGGACAAAGG - Intergenic
965676024 3:171197572-171197594 CCCAATTTAAAAATGGGCAAAGG + Intronic
966018907 3:175182219-175182241 CATAACTTAAAAATGAGCAAGGG - Intronic
966059016 3:175733053-175733075 CAGAACTTAAAAATAAAAAAGGG + Intronic
966467290 3:180244626-180244648 CTGATTTTTAAAATGGGCAAAGG - Intergenic
966590585 3:181678295-181678317 AAGGACATAAAAATGGACAATGG - Intergenic
966946684 3:184781762-184781784 CACAACTGGAAAATGGACAAAGG + Intergenic
967232019 3:187348240-187348262 CCCAATTTAAAAATGAACAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967629418 3:191727431-191727453 CTGACCTTAATATTGGACTAAGG + Intergenic
967890882 3:194363703-194363725 CTGAACTTCAAAAAGGCTAATGG + Intronic
968270097 3:197396961-197396983 CTGTAATTAAAAATGGGGAAAGG + Intergenic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
968544029 4:1186693-1186715 CTCAATTTAAAAATGGGCAGAGG + Intronic
968560203 4:1276382-1276404 AAGAAATTAAAAATGGGCAAAGG + Intergenic
968773991 4:2528093-2528115 CCCAATTTGAAAATGGACAAAGG + Intronic
969421622 4:7100919-7100941 CCCAATTTAAAAATGGGCAAAGG - Intergenic
969503189 4:7567015-7567037 CTGAACTTAGATTTGGACATAGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970622351 4:17836285-17836307 CCCAACTTAAAAATGGGCAAAGG - Intronic
970913088 4:21301550-21301572 CTGAACTTAGACATGCAAAATGG + Intronic
971249821 4:24965029-24965051 CTGTCCTTAAAAATGGTAAAAGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971484197 4:27142793-27142815 GTCAACTTAAAAACGTACAATGG + Intergenic
971717618 4:30199758-30199780 CCCAATTTAAAAATAGACAAAGG - Intergenic
971749803 4:30632398-30632420 CCCTATTTAAAAATGGACAAAGG + Intergenic
972005431 4:34097937-34097959 CCCAATTTAAAAATGGTCAAAGG + Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
972793547 4:42395270-42395292 TTGAAGTTAAAATTTGACAATGG + Intergenic
972834154 4:42848562-42848584 CTTCATTTAAAAATGGACACAGG - Intergenic
972876209 4:43364276-43364298 TCAAACTTAAAAATGTACAAGGG + Intergenic
973222587 4:47745833-47745855 TTGTACATAAAAATGGAAAAAGG + Intronic
973530123 4:51828947-51828969 CTCAATTTCAAAATGGGCAAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973788879 4:54360394-54360416 CTGATCCTAAAGATGGCCAATGG - Intergenic
973832760 4:54778716-54778738 CAGAACTGGAAACTGGACAATGG - Intergenic
974200232 4:58627805-58627827 CTGAACTTAAAAGTTAAAAAGGG + Intergenic
974623801 4:64396476-64396498 CCACATTTAAAAATGGACAAAGG - Intronic
975350267 4:73338596-73338618 CCCAATTTAAAAATGGGCAAAGG - Intergenic
975442827 4:74432490-74432512 CTGAACTTATAAATTCATAAAGG + Intergenic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
975608184 4:76177177-76177199 CTCAATTTTAAAATGGGCAAAGG + Intronic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
976458056 4:85272988-85273010 CTTTATTTAAAAATGGGCAAAGG + Intergenic
976464965 4:85356686-85356708 CTCAATTTAAAAATGCAGAATGG - Intergenic
976851771 4:89555784-89555806 CTGGATTTTAAAATGGGCAAAGG - Intergenic
977053202 4:92156297-92156319 CTTAATTTCAAAATAGACAAAGG + Intergenic
977177384 4:93834082-93834104 TTGAACTTTCAAATGGGCAAAGG - Intergenic
977492796 4:97735861-97735883 CTCGATTTAAAAATGGGCAAAGG + Intronic
977585054 4:98765782-98765804 CTCAATTTTAAAATGGGCAAGGG - Intergenic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978731692 4:112035170-112035192 CTCAACTTAAAAATGGTCTAAGG + Intergenic
979435787 4:120688304-120688326 CCCAATTGAAAAATGGACAAAGG - Intronic
979470193 4:121086943-121086965 ATGACATTAAAAATGGGCAAAGG + Intergenic
979509942 4:121541115-121541137 CTGATTTTTAAAATGGACTAAGG + Intergenic
979936561 4:126705000-126705022 CAGATTTTAAAAATGGGCAAAGG - Intergenic
980713205 4:136597205-136597227 CTGTACTTAAGGATGGGCAAAGG + Intergenic
980829893 4:138117925-138117947 CCCAATTTAAAAATGGGCAAGGG - Intergenic
981405437 4:144362130-144362152 CTTTACTTAACAATGGAGAATGG + Intergenic
981437335 4:144740850-144740872 TTAAACTTGAGAATGGACAAGGG - Exonic
981665414 4:147219632-147219654 CTGAACTTTCAAATGAAAAATGG + Intergenic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982681024 4:158430829-158430851 CTCAAATAAAAAATGGGCAAAGG + Intronic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983985743 4:174058905-174058927 CTCAATTTAAAAATAGGCAAAGG + Intergenic
984180633 4:176478608-176478630 CTCAAATTAAAGATAGACAATGG + Intergenic
984197330 4:176674516-176674538 CTGTACTTCAAACTGAACAAAGG - Intergenic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
984986711 4:185337993-185338015 CCCAATTTAAAAATGCACAAAGG - Intronic
985326602 4:188777591-188777613 ATAAACTTAAAAATAGTCAAAGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986975624 5:13389840-13389862 CCTCATTTAAAAATGGACAAAGG + Intergenic
987849338 5:23329186-23329208 CTCCACTAAAAAATGGGCAAAGG + Intergenic
987888423 5:23842644-23842666 TCCAATTTAAAAATGGACAAAGG + Intergenic
988095314 5:26600322-26600344 CTGAACTTGAAAATGTTCCATGG + Intergenic
988329760 5:29820555-29820577 CTAATATTAAAAAAGGACAAGGG - Intergenic
988740587 5:34065210-34065232 CCCCATTTAAAAATGGACAAAGG + Intronic
989132497 5:38121755-38121777 CCCAATTAAAAAATGGACAAAGG - Intergenic
989403037 5:41029294-41029316 CCTGATTTAAAAATGGACAAAGG - Intronic
989446058 5:41530026-41530048 CTGATTTTAAAAATGAGCAAAGG + Intergenic
989771271 5:45149011-45149033 ATGAACTAAAAAATAAACAAAGG + Intergenic
989954399 5:50340443-50340465 CCCAATTTAAAAATGGATAAAGG + Intergenic
990180952 5:53160054-53160076 CTCAATTCAAAAATGGGCAAAGG + Intergenic
990215409 5:53526473-53526495 CTTCATTTAAAAATGGGCAAAGG - Intergenic
990585340 5:57206065-57206087 CTCAATTTTAAAATGTACAAAGG - Intronic
990998064 5:61753308-61753330 CTGAGCTGAAAAATGGAGGATGG + Intergenic
991431853 5:66556218-66556240 CCCAATTTAAAAATGGTCAAAGG - Intergenic
992004241 5:72461838-72461860 CTGATCTTAAATGGGGACAATGG - Intronic
992129587 5:73678364-73678386 CTGTACTGAAAAATGGCAAATGG + Intronic
992307593 5:75459323-75459345 CTGAAGATAAGAATGTACAAAGG + Intronic
992329653 5:75702950-75702972 CTGAAATTAAAAATAGATTAAGG - Intronic
992428703 5:76686131-76686153 CCTAATTTTAAAATGGACAAAGG - Intronic
992433141 5:76729328-76729350 CCTGATTTAAAAATGGACAAAGG - Intronic
992519120 5:77531324-77531346 CCCAATTTAAAAATGGGCAAAGG + Intronic
992705312 5:79385418-79385440 CTCCACTAAAAAATGGGCAAAGG + Intronic
992843288 5:80717800-80717822 CCAAATTTAAAAATGGGCAAAGG - Intronic
992882196 5:81121449-81121471 ATGACAATAAAAATGGACAAAGG - Intronic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
993935350 5:93993704-93993726 CTCAAATTTAAAATGTACAATGG + Intronic
993998674 5:94752413-94752435 CTGAACTTAGGTATGTACAAGGG - Intronic
994247267 5:97492850-97492872 CTCAACATAAAATTGTACAAAGG + Intergenic
994563304 5:101406424-101406446 CTCCACTTAAAAATAGAGAATGG + Intergenic
994759734 5:103837103-103837125 CTGAGGTTAAAAAGAGACAAAGG + Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995129897 5:108619280-108619302 CCCAACTTAAAAATGGGCTAAGG + Intergenic
995146379 5:108791454-108791476 ACGAACAAAAAAATGGACAAAGG - Intronic
995167051 5:109055897-109055919 CTGTTTTTAAAAATGGGCAAAGG + Intronic
995347015 5:111133051-111133073 CTGAACTTAGAACTGGAGAAGGG + Intergenic
995553783 5:113306546-113306568 CCCAATTTAAAAATGGGCAAAGG - Intronic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995737894 5:115322490-115322512 CAAAACCAAAAAATGGACAACGG + Intergenic
995860384 5:116634696-116634718 CTGAACGTATAAGTGGGCAAGGG - Intergenic
996208210 5:120770029-120770051 CCCAATTTAAAAATGGGCAAAGG - Intergenic
996446557 5:123560042-123560064 CCCAATTGAAAAATGGACAAAGG + Intronic
996517523 5:124388864-124388886 CCTAATTCAAAAATGGACAAAGG + Intergenic
996548148 5:124702929-124702951 CTGAGCTGACAAATGAACAAAGG + Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996799096 5:127382766-127382788 CTGAACTTTAAAATAGGCAAAGG + Intronic
997864222 5:137446685-137446707 GTAAACTTAAAAATTTACAATGG - Intronic
997914686 5:137912763-137912785 TCCAATTTAAAAATGGACAAAGG - Intronic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
998062496 5:139130039-139130061 CCCAATTTAAAAATGGGCAAAGG + Intronic
998255838 5:140587047-140587069 CCCAATTTAAAAATGGGCAAAGG + Intronic
998663855 5:144273139-144273161 CCCAATTTAAAAATGGGCAAAGG + Intronic
998928218 5:147151406-147151428 CCTGATTTAAAAATGGACAAAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999333087 5:150691356-150691378 ATGGACATAAAAATGGTCAAAGG + Exonic
999421017 5:151443492-151443514 CCCAATTTAAAAATGGGCAAAGG - Intronic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
999860894 5:155644612-155644634 GTGACCTGAAAAATAGACAATGG + Intergenic
999874835 5:155792573-155792595 TCCAACTAAAAAATGGACAAAGG + Intergenic
1000108664 5:158085821-158085843 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1000131899 5:158308215-158308237 CTAAAATCAAAAATAGACAAAGG + Intergenic
1000160901 5:158596965-158596987 CCTAACTAAAAAATGGTCAAAGG - Intergenic
1001081900 5:168673248-168673270 CTGAACCTAGTAGTGGACAAAGG - Exonic
1001531770 5:172467432-172467454 CCTAATTCAAAAATGGACAAAGG - Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002651497 5:180699492-180699514 CCCAACTCAATAATGGACAAAGG + Intergenic
1002678973 5:180945630-180945652 CTGATCTTAAAAAAGGGGAAAGG + Intronic
1002923471 6:1590536-1590558 CAGATCTTAAAAATGCACATTGG + Intergenic
1002941623 6:1721733-1721755 TTTAACTTAAAAATTCACAAAGG - Intronic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003022977 6:2528117-2528139 CAGAACTTTAAAAAGGAGAAAGG - Intergenic
1003023519 6:2532305-2532327 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1003355260 6:5363226-5363248 AATAACTTAAAAATGGGCAAAGG - Intronic
1003724046 6:8739003-8739025 ATCCACTTAAAAATGGGCAAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004770151 6:18772071-18772093 CTTAACCTAAAATTGGACAAGGG - Intergenic
1004951540 6:20678362-20678384 CTAAAATTAAAAAGAGACAAAGG - Intronic
1005907166 6:30273356-30273378 CCTAATTCAAAAATGGACAAAGG + Intergenic
1006260865 6:32869054-32869076 CAAAAATTAAATATGGACAAAGG + Intergenic
1007047215 6:38788607-38788629 CTCAATTTAAAAATGAGCAAAGG - Intronic
1007063734 6:38968450-38968472 CCCAATTTAAAAATGGGCAAAGG + Intronic
1007868890 6:45009098-45009120 CCCAATTTAAAAATGGGCAAAGG - Intronic
1007934529 6:45721295-45721317 CTGGCCTTGAAAATGGAGAAAGG + Intergenic
1008331876 6:50255136-50255158 CTGAACTTAAAAATAGGAAGCGG - Intergenic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008747246 6:54687041-54687063 TTGAAATTGAAAATGTACAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009044728 6:58224870-58224892 CCCAACTTAAAAATGAAGAAAGG + Intergenic
1009220542 6:60979150-60979172 CCCAACTTAAAAATGAAGAAAGG + Intergenic
1009356707 6:62756938-62756960 CTGAATTTTAAAATTGAGAAAGG - Intergenic
1009559928 6:65226447-65226469 ACCAATTTAAAAATGGACAAGGG + Intronic
1009856193 6:69267397-69267419 CTGAAATTAATAATGGACTCCGG - Intronic
1009964272 6:70562361-70562383 CTGGACTTAAAACTGGATGAGGG - Intergenic
1010006901 6:71005397-71005419 AAAAACTTAAAAATGGCCAACGG - Intergenic
1010689006 6:78887202-78887224 CTGATTTTAAAAATGAACGAAGG + Intronic
1010907568 6:81510579-81510601 CTCAATTTAAAAATGAGCAAAGG - Intronic
1011045363 6:83076154-83076176 CTGAATTTTAAAATGGGCCAAGG + Intronic
1011368481 6:86606416-86606438 CTCGATTTAAAAATGGGCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011741660 6:90367316-90367338 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1011866013 6:91828833-91828855 CAGAATTTAAAAATGGCCACAGG - Intergenic
1012128424 6:95459332-95459354 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1012148536 6:95717427-95717449 CTGATATTAAAAATGAGCAAGGG - Intergenic
1012256081 6:97033847-97033869 CTGAATTTTAAAATGGTCACAGG - Intronic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012544276 6:100399115-100399137 CTCAATTCAAAAATGGGCAAAGG - Intronic
1012789021 6:103668665-103668687 CCCAATTTAAAAATGAACAAAGG - Intergenic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013304528 6:108836108-108836130 CCCAATTTAAAAATGGCCAAAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013716714 6:112970899-112970921 CTGAACTTAAAAGTTCAAAAAGG + Intergenic
1013943958 6:115700065-115700087 CTTGATTTAAAAATGGATAAAGG - Intergenic
1014034029 6:116744593-116744615 CCCAATTAAAAAATGGACAAAGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015459875 6:133477437-133477459 CTCAAATAAAAAATGGGCAATGG - Intronic
1015664445 6:135612096-135612118 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1015734144 6:136379717-136379739 CTGAACTTCTTAATGGAGAAAGG - Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016106258 6:140166715-140166737 CCCAATTCAAAAATGGACAAAGG - Intergenic
1016679347 6:146810126-146810148 CTGGTTTTAAAAATGGGCAAAGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017016326 6:150103271-150103293 CTCAATTTTAAAATGGGCAAAGG + Intergenic
1017036365 6:150270832-150270854 CTGAACTTAAAAATGTAAGGAGG + Intergenic
1017436325 6:154418985-154419007 CTGATTTTAAAAATGGGTAAAGG + Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018322899 6:162632465-162632487 CTGGACATAACAATGGACACTGG + Intronic
1018377262 6:163225013-163225035 CCCAATTTAAAAATGGGCAAAGG + Intronic
1019303264 7:319930-319952 TTCAACTTGAAAATGGGCAAAGG + Intergenic
1019616383 7:1964826-1964848 CTGAACTAAAAGATGCATAATGG + Intronic
1019885686 7:3902947-3902969 CCTAATTTTAAAATGGACAAAGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1020145459 7:5638969-5638991 CTCAACTCAAAAATGGACAGAGG - Intronic
1020603079 7:10300911-10300933 CTGAACTTAAAAATACCTAAGGG + Intergenic
1021094129 7:16515854-16515876 CTCAACTAAAAAATGGGTAAAGG + Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021346311 7:19532957-19532979 CTCCATTTAAAAATGGGCAAAGG + Intergenic
1021497119 7:21288155-21288177 CTTGATTTAAAAATGGGCAAAGG + Intergenic
1021697797 7:23290855-23290877 CTGATTTTTAAAATGGGCAAAGG - Intergenic
1022056366 7:26739468-26739490 CTGAAATGAATAATAGACAATGG + Intronic
1022147614 7:27561129-27561151 CCCAGTTTAAAAATGGACAAAGG - Intronic
1022202974 7:28136007-28136029 CTGAAGTGAAACATGGAGAATGG - Intronic
1022335682 7:29419660-29419682 CCCAATTTAAAAATGGGCAAAGG + Intronic
1022625227 7:32029059-32029081 CCTAATTTAAAAATGGGCAAGGG + Intronic
1023062901 7:36345988-36346010 CTCAACTGAAAAATTGGCAAAGG + Intronic
1023372360 7:39524461-39524483 CTCAATTTAAAAATGAGCAAAGG + Intergenic
1023421058 7:39980247-39980269 GTGAAATTAAAAATAGAGAATGG + Intronic
1023614490 7:42006132-42006154 CTGTACTTAAAAAAGTATAAGGG + Intronic
1023685462 7:42730085-42730107 CTGAACTTAAAAATATAAATAGG + Intergenic
1023741425 7:43284569-43284591 TTGATCTTGAAAATTGACAAGGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024020943 7:45368430-45368452 CTCAACTAAAAAATGTACAAAGG - Intergenic
1024317108 7:48031198-48031220 CTGAATTTAAAAGTTGGCAAAGG + Intergenic
1024371653 7:48591235-48591257 CTGAAATTAAAACTGGGAAAAGG - Intronic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1025705721 7:63860640-63860662 ATGTACTTAAAATTGGCCAAGGG - Intergenic
1026485992 7:70821877-70821899 CTCAATTTAAAAATGGGTAAAGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1028501585 7:91524978-91525000 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028904808 7:96140928-96140950 CTGATTTTAAAAATGAGCAAAGG - Intronic
1029009786 7:97247066-97247088 CCTGACTTAAAAATGGGCAAAGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1029245718 7:99199893-99199915 TTTGACTTAAAAATGGACAAAGG + Intronic
1030183535 7:106736240-106736262 CTGATCTTAAAAATTCACTAAGG - Intergenic
1030238048 7:107288622-107288644 CCCAACTAAAAAGTGGACAAGGG - Intronic
1030331979 7:108280653-108280675 GTCCAGTTAAAAATGGACAACGG - Intronic
1030412169 7:109194562-109194584 CTCAATTTAAAAATGGGCCAAGG - Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032674615 7:134117674-134117696 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1033011535 7:137627593-137627615 GTGGACTTAAAAATGAACATCGG - Intronic
1033633928 7:143190626-143190648 CTGAAGTTAAAAATTGGCAAAGG + Intergenic
1033982163 7:147178718-147178740 CTTAGCTTAAATATGGTCAAAGG - Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034173818 7:149084626-149084648 CTGCATTAAAAAATGGGCAAAGG - Intronic
1034375822 7:150643021-150643043 TGCAACTTAAAAATGGACAATGG - Intergenic
1034402383 7:150871653-150871675 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035046052 7:155966855-155966877 CTCAATTTAAAAGTGGGCAAAGG + Intergenic
1036287300 8:7454955-7454977 ACACACTTAAAAATGGACAAAGG + Intronic
1036334180 8:7856570-7856592 ACACACTTAAAAATGGACAAAGG - Intronic
1036636365 8:10552593-10552615 CCCAATTTAAAAATGGGCAAAGG + Intronic
1037096810 8:14995670-14995692 CTGAACTTAAGGAAGGATAAGGG - Intronic
1037269525 8:17111164-17111186 CCTAATTTAAAAATGGGCAAAGG - Intronic
1037382980 8:18308044-18308066 CTCAATTTTAAAATGGTCAAAGG + Intergenic
1037532015 8:19786154-19786176 CTGAACTTAAAATAGAACGATGG + Intergenic
1037629822 8:20644800-20644822 CTTCATTTAAAAATGGTCAAAGG - Intergenic
1037782921 8:21883211-21883233 CCCAATTCAAAAATGGACAAAGG + Intergenic
1038080921 8:24135277-24135299 TTGAACTTAAAAATGCCCAATGG + Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038787531 8:30633516-30633538 ATCAACTTAAATATGTACAAAGG + Intronic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038852461 8:31293196-31293218 ATAAATTTAAAAATGGGCAAAGG - Intergenic
1039267963 8:35848134-35848156 CTGATTTTAAAACTGGGCAAAGG + Intergenic
1039269449 8:35864934-35864956 CAGAACTGATAAATGTACAATGG + Intergenic
1039581868 8:38673579-38673601 CCTAATTTAAAAATGGGCAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040060459 8:43099251-43099273 CTCAATTTAAAAATGTGCAAAGG - Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041049480 8:53919210-53919232 CCCAATTTAAAAATGGAGAAAGG - Intronic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041592404 8:59603556-59603578 CCCAACTTAAAAATGGCCAAGGG - Intergenic
1042104352 8:65308905-65308927 CTGAGATTAAAAATGTCCAAGGG - Intergenic
1042293300 8:67192374-67192396 TTCAATTTGAAAATGGACAAAGG - Intronic
1042425833 8:68647110-68647132 CCCAATTTAAAAATGGGCAAAGG + Intronic
1042570167 8:70155356-70155378 CTGATCTTAAAAAGAGAGAAAGG + Intronic
1042586101 8:70340259-70340281 CTCCACTAAAAAGTGGACAAAGG + Intronic
1042794302 8:72643754-72643776 CTGGACTTATACATGAACAAAGG + Intronic
1042901057 8:73728023-73728045 CTCAACTAAAAAATGGGCAAAGG - Intronic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043307376 8:78812718-78812740 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1043346705 8:79306122-79306144 CCAATTTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043680306 8:83016402-83016424 CTGGTCTTAAAAATGTAAAAAGG - Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1043767037 8:84149135-84149157 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044175565 8:89116905-89116927 CCCAATTTAAAAATGGACCAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044483515 8:92722043-92722065 CCCCATTTAAAAATGGACAAAGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045740431 8:105352097-105352119 CTGAGCTTAATTATGGCCAATGG + Intronic
1046408358 8:113804944-113804966 CCTAATTTAAAAATGGGCAAAGG - Intergenic
1047602649 8:126441820-126441842 CTAATTTTTAAAATGGACAAAGG + Intergenic
1047652863 8:126942695-126942717 CTCAATTTAAAAATAGGCAAAGG - Intergenic
1047711645 8:127558715-127558737 CTGAACTTGAAAAAGGACAAAGG + Intergenic
1047759136 8:127941132-127941154 CTGGACTTGAAAATGGAGAGAGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049866053 8:144936993-144937015 CCCAATTTAAAAATGGGCAAAGG - Intronic
1049993953 9:1016988-1017010 CACAATTTAAAAATAGACAAAGG - Intergenic
1050241385 9:3639394-3639416 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1050754174 9:8979555-8979577 CTCCACTTAAAAATGGGCAAAGG + Intronic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051324622 9:15951689-15951711 CTGATTTAAAAAATGGGCAAAGG - Intronic
1051366563 9:16325518-16325540 CTGGACTGAAACAGGGACAAAGG - Intergenic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1051716091 9:19986099-19986121 CTCAATTTAAAAATAGGCAAAGG + Intergenic
1051797951 9:20896334-20896356 CTAAAATTAAAACTAGACAAAGG - Intronic
1051875818 9:21792130-21792152 CTGATTTAAAAAATGGGCAAAGG + Intergenic
1052171662 9:25405750-25405772 CTGAACTTAAAATTAAATAAGGG - Intergenic
1052255393 9:26449929-26449951 GTCAATTTAAAAATGGGCAAAGG + Intergenic
1052350384 9:27452564-27452586 CATAATTTAAAAATGGGCAAAGG + Intronic
1052500094 9:29278153-29278175 CCCATTTTAAAAATGGACAAAGG - Intergenic
1052713422 9:32086186-32086208 CTTAATTGAAAAATGCACAAAGG + Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054834708 9:69664968-69664990 CTGAACTCAGAAGTGGACATGGG - Intronic
1055779926 9:79809613-79809635 CTGAGCTTAAATATGTACATAGG - Intergenic
1055940123 9:81641596-81641618 CCTAATTTAAAAATGGGCAAAGG + Intronic
1055983175 9:82026484-82026506 CTCAACTTAAAAATGAGCAAAGG - Intergenic
1056136692 9:83636269-83636291 CAGCACTTATAAATGGATAAAGG + Intronic
1056263497 9:84873123-84873145 CTGACCATCAAAATGGACCATGG - Intronic
1056433787 9:86555579-86555601 CTCAATTTAAAAAGGGGCAAAGG + Intergenic
1057464060 9:95295411-95295433 CTGATCTTTTAAATGGTCAAAGG + Intronic
1057620408 9:96629654-96629676 CTGCATTTAAAAATGGAAAGAGG - Intergenic
1057740551 9:97707723-97707745 ATCAATTTTAAAATGGACAAAGG - Intergenic
1057760046 9:97864738-97864760 CTTAATTCAAAAATGGGCAAAGG - Intergenic
1057972754 9:99573257-99573279 ATGAAGTTAAAAATAGACATTGG + Intergenic
1057979309 9:99642871-99642893 CTCAATTTGAAAATGGCCAAAGG + Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058278964 9:103086759-103086781 TATAACTGAAAAATGGACAAAGG - Intergenic
1058319637 9:103612851-103612873 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1058367140 9:104221608-104221630 CCCAACTGAAAAATGGGCAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059358763 9:113722557-113722579 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1059614692 9:115936341-115936363 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1059825831 9:118028083-118028105 ATGAACTCTAAAATGGAGAAAGG + Intergenic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1061329676 9:129884760-129884782 CTGAATTTAAAACAGAACAAAGG - Intergenic
1061755704 9:132810957-132810979 CTTAACTGGAAAATGGGCAAAGG + Intronic
1062701810 9:137910214-137910236 CTCAATTTTAAAATGGGCAACGG - Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1185841581 X:3396881-3396903 CTGAATTTAAAAAATTACAAAGG - Intergenic
1186767532 X:12786395-12786417 CCGAATTTTAAAATGGGCAAAGG - Intergenic
1186902490 X:14072189-14072211 CCCAACTGAAAAATGGGCAAAGG - Intergenic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187326886 X:18299209-18299231 CTTAATTAAAAAGTGGACAAAGG + Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187685899 X:21815168-21815190 TTGAACTTAAAAATGGCCTTGGG - Intergenic
1187910553 X:24107177-24107199 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188138337 X:26517524-26517546 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1188454664 X:30350032-30350054 CCCAACTTAAAAATGGGCAAAGG + Intergenic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1188542222 X:31263547-31263569 CTTAACTCACAAATGGGCAATGG - Intronic
1188584917 X:31762213-31762235 CTGTACTTTAAAATGGAAGAAGG - Intronic
1188664000 X:32795775-32795797 ATCACATTAAAAATGGACAAAGG + Intronic
1188897705 X:35689237-35689259 CACAATTTAAAAATGGTCAATGG - Intergenic
1188952533 X:36393814-36393836 GTGCACTTAAAAATGGTTAAAGG - Intergenic
1189448647 X:41105947-41105969 CTCAATTGAAAAATGGGCAAAGG - Intronic
1189538854 X:41965268-41965290 TTAAATTTAAAAATGGGCAAAGG + Intergenic
1189686412 X:43568355-43568377 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1189699718 X:43705776-43705798 CCCAATTCAAAAATGGACAAAGG + Intronic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1189764405 X:44355535-44355557 CCCAATTTAAAAGTGGACAAAGG + Intergenic
1189892099 X:45613641-45613663 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1190089123 X:47422156-47422178 CCCAACTAAAAAATGGGCAAAGG + Intergenic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1190122700 X:47675403-47675425 CCCAACTAAAAAATGGGCAAAGG - Intergenic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190578252 X:51863800-51863822 CCCAATTTAAAAATGGGCAAAGG - Intronic
1190724912 X:53182668-53182690 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191822045 X:65321206-65321228 CTCAATTAAAAAGTGGACAAAGG + Intergenic
1191836827 X:65472208-65472230 CTCAATTTAAAAATGAATAAAGG - Intronic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192281131 X:69687238-69687260 CTCAATTGAAAAATGGGCAAAGG - Intronic
1192749369 X:73972582-73972604 CCCAATTTAAAAATGGGCAAGGG - Intergenic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193767781 X:85551933-85551955 CTAATTTCAAAAATGGACAAAGG - Intergenic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194162626 X:90472808-90472830 CTGTACTTAAATTTGGACAGGGG - Intergenic
1194433548 X:93841177-93841199 CCCCACTTAAAAATGGGCAAAGG - Intergenic
1194652171 X:96529028-96529050 CCCAAATAAAAAATGGACAAAGG + Intergenic
1194876478 X:99195116-99195138 CCCAACTGAAAAATGGGCAAAGG - Intergenic
1195059553 X:101180435-101180457 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1195653237 X:107309429-107309451 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1195714141 X:107802004-107802026 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1195781492 X:108470470-108470492 CTCCATTTAAAAATGGGCAAAGG - Intronic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1196015249 X:110932698-110932720 TTCAACTAAAAAATGGCCAATGG + Intergenic
1196333868 X:114506866-114506888 TGCAACTTAAAAATGGACAAAGG + Intergenic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196476766 X:116096087-116096109 CTTATTTTTAAAATGGACAAAGG - Intergenic
1196516071 X:116613626-116613648 CTCAACTTGAAAGTGGGCAAAGG + Intergenic
1196637740 X:118022660-118022682 CACAACTTAAAAATGAGCAAAGG - Intronic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1196930700 X:120679152-120679174 CCCAATTTAAAAATGGTCAAAGG - Intergenic
1197411995 X:126128168-126128190 ATGAACTCAAAAATGGATCATGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197651246 X:129067225-129067247 CCCAACTTAAGAATGGGCAAAGG + Intergenic
1197680867 X:129382993-129383015 CTGAACTTAAAAGTTAAAAAAGG + Intergenic
1197847636 X:130820129-130820151 CCGATTTTAAAAATGGACAAAGG + Intronic
1197882673 X:131184099-131184121 CTGATATCAAAACTGGACAAGGG - Intergenic
1197900880 X:131370138-131370160 GTGGAATTAAAAATGTACAAAGG + Intronic
1197993466 X:132345001-132345023 ATCAGCTTAAAAATGGACCAAGG + Intergenic
1198152921 X:133928757-133928779 CTTGATTTAAAAATGGGCAAAGG - Intronic
1198192261 X:134319886-134319908 CCAAATTTAAAAATGGGCAAAGG + Intergenic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1198890027 X:141383848-141383870 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1199205873 X:145147300-145147322 CCCAATTAAAAAATGGACAAAGG - Intergenic
1199744486 X:150763266-150763288 CTAAACGTAAAAAAGGACATAGG - Intronic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200291891 X:154883428-154883450 CCGAATTAAAAAATGGGCAAAGG + Intronic
1200338729 X:155379165-155379187 CCGAATTAAAAAATGGGCAAAGG + Intergenic
1200347740 X:155461527-155461549 CCGAATTAAAAAATGGGCAAAGG - Intergenic
1200508903 Y:4050542-4050564 CTGTACTTAAATTTGGACAGGGG - Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201375242 Y:13312048-13312070 CCGCACTAAAAAATGGACAAAGG + Intronic
1201538538 Y:15080207-15080229 ATGTAGTTAAAAATGGATAACGG + Intergenic
1201541747 Y:15112315-15112337 CAGAACATGAAAGTGGACAAGGG + Intergenic
1201584325 Y:15544399-15544421 ATGAACTGGACAATGGACAATGG + Intergenic