ID: 1032614505

View in Genome Browser
Species Human (GRCh38)
Location 7:133452415-133452437
Sequence GCTGCTTCTCATCACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032614505_1032614509 4 Left 1032614505 7:133452415-133452437 CCCACATGGTGATGAGAAGCAGC 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1032614509 7:133452442-133452464 GTTGTGTCTGAGGAGGAAGTTGG 0: 1
1: 0
2: 2
3: 33
4: 311
1032614505_1032614508 -3 Left 1032614505 7:133452415-133452437 CCCACATGGTGATGAGAAGCAGC 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1032614508 7:133452435-133452457 AGCAAATGTTGTGTCTGAGGAGG No data
1032614505_1032614507 -6 Left 1032614505 7:133452415-133452437 CCCACATGGTGATGAGAAGCAGC 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1032614507 7:133452432-133452454 AGCAGCAAATGTTGTGTCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032614505 Original CRISPR GCTGCTTCTCATCACCATGT GGG (reversed) Intronic
900242189 1:1622382-1622404 GCTGCCTCTCTCCACCATGCTGG - Intronic
900469091 1:2843108-2843130 CCTTCTTCCCATCACCCTGTGGG - Intergenic
904065829 1:27750011-27750033 GCTGCTTCTCAACAAAGTGTTGG + Intronic
913484192 1:119318725-119318747 GCTGCATGTCATCAGCATATGGG - Intergenic
913486478 1:119336283-119336305 GCTGCTCCTGTTCACCATGCAGG - Intergenic
915092170 1:153434275-153434297 ATTGATTCTGATCACCATGTGGG + Intergenic
916269170 1:162921591-162921613 GCTACTGCTCATCATGATGTGGG + Intergenic
922580285 1:226692227-226692249 GCTGCCTCTCAAAATCATGTGGG + Intronic
1064642775 10:17431196-17431218 GCTAGTTCTCATCCTCATGTCGG - Intronic
1065978135 10:30862077-30862099 CCTGCTGCTTTTCACCATGTTGG - Intronic
1072166052 10:92814113-92814135 ACTGCTTCTCATCTTCTTGTCGG + Intergenic
1072984462 10:100127882-100127904 GCTGCTAATAATCACCAGGTTGG - Intergenic
1073939171 10:108674451-108674473 GCTGCAACACATCCCCATGTAGG + Intergenic
1074386443 10:113020287-113020309 GCTGCCTCCCATCAGCATGGAGG - Intronic
1075588879 10:123677333-123677355 GGTGCTGCTCATCCCCATGGAGG - Intronic
1076794674 10:132792797-132792819 GCTGCTTCTCTTCTCCCTGGTGG + Intergenic
1077261125 11:1621638-1621660 GCTGCTTCTCTTCAGGCTGTGGG - Exonic
1077916927 11:6617381-6617403 GCTGAGTTTCATCACTATGTGGG - Exonic
1079727729 11:23897067-23897089 TCTCCCTCTCTTCACCATGTAGG - Intergenic
1082987590 11:59181866-59181888 GCTGCTTCTCATAGGCATGCTGG - Exonic
1083416038 11:62526430-62526452 GCAGCTTCACATCCCCATCTGGG + Exonic
1085803688 11:79614838-79614860 CTTGCTTCTCCTCACCATTTTGG + Intergenic
1088794149 11:113253384-113253406 GCTGTTTCTCATGACATTGTGGG - Intronic
1089807465 11:121104411-121104433 GCTGCTTCTCAGCAACTTCTGGG + Intronic
1091981162 12:4865255-4865277 GTTGCTAATCATCTCCATGTCGG - Intergenic
1093497947 12:19779342-19779364 GCCCCTGCTCATCACCAGGTGGG - Intergenic
1095835790 12:46637702-46637724 TCTGTTCCTCATCACCATGTGGG + Intergenic
1104345038 12:127988394-127988416 GCTGCTTCTCATGTACATATCGG + Intergenic
1107124890 13:36836478-36836500 GATGCTTCTAATCAGCATGATGG - Intergenic
1113570125 13:111347621-111347643 GCTGATTCACATCAACTTGTGGG - Intergenic
1114330773 14:21634680-21634702 GCTCATTCTGCTCACCATGTGGG - Exonic
1116971181 14:51067691-51067713 GCCCCTTCTCATCACCATTTAGG + Intronic
1118210267 14:63759726-63759748 GCTGCTTCTCTTCACCTTCTTGG + Intergenic
1119537658 14:75416087-75416109 GCTGCTTCTGATGTCCCTGTGGG + Intergenic
1121225284 14:92317273-92317295 TCTGCTTCTCATCATCACTTAGG - Intergenic
1124943956 15:34245771-34245793 GCTCCTTCTTTTCAACATGTGGG - Exonic
1126468718 15:48984316-48984338 GCTGCATTTCCTCAACATGTTGG - Intergenic
1127360915 15:58244498-58244520 GCTGCTGCCCATCTCCACGTGGG + Intronic
1127950745 15:63803381-63803403 GCTGCTTCTTATCAACATCGTGG + Intronic
1129328873 15:74816610-74816632 GCTGCTTCTCACCTCCCTGCAGG + Exonic
1130247364 15:82263627-82263649 ACTGCTTTCCATCAACATGTAGG - Intronic
1130541955 15:84826835-84826857 GCTGCTTCCCAGCCCCATTTCGG + Intronic
1131388492 15:92028096-92028118 GGTGCCTCTGAGCACCATGTGGG + Intronic
1131643040 15:94313050-94313072 GCTGCCTCTCATCTCCAAATTGG + Intronic
1133297107 16:4759848-4759870 GATGGGTTTCATCACCATGTTGG - Intronic
1133561833 16:6957551-6957573 GGTGACTCTCATCACCATCTTGG + Intronic
1135169772 16:20173561-20173583 GATCTTTCTCATCACCATCTTGG - Intergenic
1137595332 16:49719914-49719936 GTTGCCTCTCAACACCATCTGGG + Intronic
1137764457 16:50967350-50967372 GCTGGTTCTCAGCACCCAGTAGG + Intergenic
1137859924 16:51836341-51836363 TCTGCTTCACATCACCCTGTGGG + Intergenic
1138190856 16:55012934-55012956 GCTGCAGCCCATCACCCTGTAGG + Intergenic
1138512884 16:57518757-57518779 GGTGGTTCTCATGACCAGGTGGG - Intronic
1142270671 16:89087864-89087886 GCGTCTGCTCTTCACCATGTAGG + Intergenic
1144887100 17:18470795-18470817 TCACCTTCTCATCACCAAGTAGG + Intergenic
1145145116 17:20473500-20473522 TCACCTTCTCATCACCAAGTAGG - Intergenic
1145273208 17:21415399-21415421 GCTGCACCTGGTCACCATGTCGG + Exonic
1145311401 17:21702843-21702865 GCTGCACCTGGTCACCATGTCGG + Exonic
1145990638 17:29077463-29077485 GCTGGTCCTCATCACCAGATGGG + Exonic
1151715506 17:75829052-75829074 GCTGGTTCCCAACACCAAGTGGG - Intronic
1153958067 18:10115127-10115149 GATGCTTTTCATCACCACATTGG + Intergenic
1155980843 18:32177827-32177849 GCTTCTTCTCACCACCATGGTGG + Intronic
1157521098 18:48346110-48346132 GCTTCTCTTCCTCACCATGTTGG + Intronic
1158572980 18:58612391-58612413 GCTCCTTCTGAGCACCAGGTGGG + Intronic
1159582179 18:70245700-70245722 GCTGCTTCTCCTCTCTCTGTCGG - Intergenic
1160087959 18:75796868-75796890 GATGCTACTCAACATCATGTTGG + Intergenic
1161564963 19:4996891-4996913 GCTGCTGCTCAGCACCCTGCAGG - Intronic
1163722142 19:18903408-18903430 GCAGCTTCTCACCACCCTGCAGG + Exonic
1167680352 19:50916459-50916481 GCTGCATCTCATCCGCAGGTGGG - Intergenic
925004546 2:430887-430909 GCTGATTCTCATGACTCTGTGGG + Intergenic
925132522 2:1503762-1503784 TCTGCTCCTCATCACCTTTTCGG + Intronic
925823359 2:7822543-7822565 GCTGCTGCTCAGCACCAGGTGGG - Intergenic
926651544 2:15352127-15352149 TTTGCTTCTCATCACAATATAGG + Intronic
928166083 2:28973142-28973164 GCTTCTCCTCATCACCCTGTGGG - Intronic
929899587 2:45989151-45989173 GCTTTTTCTCATCCCCATCTGGG + Intronic
930846981 2:55917042-55917064 CCTGCTTCTCATTACCTTGGAGG - Intronic
933051857 2:77611042-77611064 CCTGCTGCTCATCACCAGGCAGG + Intergenic
933427336 2:82129671-82129693 GGTCACTCTCATCACCATGTTGG - Intergenic
938113847 2:128590297-128590319 GCTCCCTCTCACTACCATGTGGG + Intergenic
938991348 2:136632946-136632968 GCTGCTATGCATCACCATGGAGG - Intergenic
940190729 2:151037524-151037546 GCTCACTCTCATCACCATCTTGG - Intronic
941869351 2:170367353-170367375 TCTGTTTCTCATCACCAAATAGG - Intronic
942087359 2:172455970-172455992 TCTGCTTTTCTTCACCAGGTGGG + Intronic
942424663 2:175847042-175847064 GCTGACTCTCACCACCATGGTGG - Intergenic
943258718 2:185630463-185630485 ACTGCTTCTCAACCCTATGTTGG + Intergenic
943702034 2:190997024-190997046 GCAGGTTCTCAGCACCATGCTGG - Intronic
944196458 2:197059691-197059713 GCTGAATCACATCACCATCTGGG - Intronic
945783661 2:214207214-214207236 GCTGATTCTCAACATCAGGTAGG + Intronic
946039369 2:216770686-216770708 GCTGCTTCTCATCTCTTTGGAGG + Intergenic
946156213 2:217808333-217808355 TCTGCTTCTCCTCTCCATGATGG - Intronic
948483930 2:238268101-238268123 GCTGACTCTCAGCACCTTGTTGG + Exonic
1169193114 20:3670108-3670130 GCTGCTTCTCATCCCCAGGCGGG - Intronic
1169267319 20:4174631-4174653 GCTGCCTCTCATCTCCACTTTGG + Intronic
1173294996 20:41748348-41748370 GCTGCTCCTCAGCACCGTGGAGG + Intergenic
1174037477 20:47677153-47677175 CCTGCTTCTCAGCAACATGAGGG + Intronic
1175616359 20:60403124-60403146 GATCTTTATCATCACCATGTAGG + Intergenic
1175980182 20:62734932-62734954 GCTGCTTCTCATCAGCAGGGAGG - Intronic
1176059150 20:63164707-63164729 GCCTCTTCCCACCACCATGTGGG - Intergenic
1176240779 20:64074941-64074963 CCTGCTTCTCAACCTCATGTGGG - Intronic
1178700645 21:34830832-34830854 GCTGGTTGTCATAAGCATGTAGG - Intronic
1179974476 21:44856332-44856354 GGCGCTGATCATCACCATGTCGG - Exonic
1180935813 22:19624702-19624724 GGTCATTCTCATCACCATCTTGG - Intergenic
1183849789 22:40575653-40575675 GGTGCTGTTCATCACCATATTGG - Intronic
949562309 3:5214120-5214142 GCTGCTTCTCAGGACAATCTAGG - Intronic
949580857 3:5386315-5386337 GCTGCCTCTCTTCTCGATGTTGG + Intergenic
949870049 3:8580664-8580686 TCTCCTACTCAACACCATGTGGG - Intergenic
952123641 3:30274813-30274835 GGTATCTCTCATCACCATGTTGG - Intergenic
953348101 3:42192893-42192915 GCTGCTTTGCTTCTCCATGTGGG + Intronic
953683959 3:45061490-45061512 GTTCCCTCTCATCACCATCTTGG - Intergenic
953755433 3:45642122-45642144 GCTGCTTCTCATCAGCAGATGGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954936281 3:54329908-54329930 GCTGCTCCTCACCTCCATATGGG - Intronic
955716876 3:61838505-61838527 CCTGATTTTAATCACCATGTGGG - Intronic
956248534 3:67211503-67211525 TCAGCTTCTCATCATCATGAAGG - Intergenic
957357372 3:79109998-79110020 GTTGCTTCTCATACCAATGTAGG - Intronic
957989552 3:87611855-87611877 GCTGCTTCTCAAGAGCATGGGGG - Intergenic
960341996 3:116486020-116486042 CCTGCTTCTCCTCACTAGGTAGG + Intronic
960788915 3:121404802-121404824 GCTTCTTTTCATCATCCTGTGGG - Intronic
966000507 3:174943717-174943739 CCTGCTGCTCATCACCAAATAGG - Intronic
968442858 4:633358-633380 GCTGCTGCCCATAGCCATGTGGG - Intronic
975248439 4:72148149-72148171 ACTGCTCATCATCACCATTTGGG - Intergenic
976461788 4:85320467-85320489 GCTGCATCCAATGACCATGTGGG - Intergenic
979715445 4:123832104-123832126 GCTGCTTCTCAACTCCCAGTTGG + Intergenic
982821780 4:159949644-159949666 GCTGCTTGGTAGCACCATGTTGG - Intergenic
983277017 4:165630136-165630158 GCTGCTTCTTATATCTATGTTGG + Intergenic
983996252 4:174186228-174186250 CCATCTTCTCATCACCCTGTGGG - Intergenic
985046335 4:185944253-185944275 GGTGCTTCTCATCTCTATTTGGG - Intronic
985969582 5:3364501-3364523 GCCTCTTCTCATCATCATGAAGG - Intergenic
990628636 5:57642348-57642370 GCTGCATCTCATCCCCTTGCAGG + Intergenic
990941669 5:61208268-61208290 TCTGCTTCTCATCCCAATGTTGG + Intergenic
995486181 5:112642202-112642224 CCCTCTTCTCTTCACCATGTAGG - Intergenic
996565214 5:124872876-124872898 GCCCCTTCTCTTCCCCATGTTGG + Intergenic
996827027 5:127695469-127695491 GTTGTTTCTCAGCACCATGATGG - Intergenic
1000060933 5:157654741-157654763 GGTAATTCTCATCACCATCTTGG - Intronic
1002638508 5:180619614-180619636 GCTGCTGCTCCTCACCAGCTAGG + Intronic
1003736710 6:8885731-8885753 TCTGCTTCTCATCCCAAAGTTGG + Intergenic
1004804969 6:19193567-19193589 GGTGCTTCTCTTCACCAAATAGG - Intergenic
1010136343 6:72558306-72558328 GCAGCTTGTCAACACCATTTGGG - Intergenic
1017155215 6:151316822-151316844 GGTTCTACTCTTCACCATGTTGG + Intronic
1018064629 6:160116580-160116602 GCTGCTTCCCATCCACATGCAGG + Intergenic
1019204603 6:170349719-170349741 GCTGCTTCTAATCAGCCTCTTGG - Intronic
1022893096 7:34720832-34720854 TCTGCTTCTAATCATCAAGTCGG + Intronic
1025907891 7:65802593-65802615 GGTGCCTCTCAACACCATGGAGG - Intergenic
1027796474 7:82700170-82700192 GCTCCCTCTCATCACCATCTTGG - Intergenic
1028323877 7:89497688-89497710 TCTGTTTCTCATTCCCATGTTGG - Intergenic
1031708129 7:125008387-125008409 GCTCCTTCACATTATCATGTAGG - Intergenic
1032343356 7:131096695-131096717 GCTGCTTTTCATCTCCATGAAGG - Intergenic
1032614505 7:133452415-133452437 GCTGCTTCTCATCACCATGTGGG - Intronic
1032718240 7:134529071-134529093 ACTGCTTCTCATCACTAGTTAGG - Intronic
1032723077 7:134566609-134566631 ACTGCTTCTCATCACTAGTTAGG - Intronic
1035047229 7:155975626-155975648 GCTCCTCCTCATTTCCATGTGGG - Intergenic
1037503269 8:19505708-19505730 GCTGCTCCTCGTCACCTTTTGGG + Exonic
1038125817 8:24671647-24671669 GGTCATTCTCATCACCATCTTGG - Intergenic
1039596791 8:38797635-38797657 TCAGCTTCTCAGCTCCATGTGGG + Intronic
1040639539 8:49317146-49317168 GCTGCTGCTGATGACAATGTTGG + Intergenic
1042535898 8:69858968-69858990 GCTGCTTCTTATCAGCAGGAGGG - Intergenic
1049035878 8:140075471-140075493 CCTGCTTATCGCCACCATGTGGG + Intronic
1052847667 9:33351518-33351540 CCAGATTCTCATCTCCATGTGGG - Intronic
1056892321 9:90506585-90506607 GCTCACTCTCATCACCATCTTGG + Intergenic
1060971330 9:127739829-127739851 GCTGCCCCTCATCACCCTGCTGG - Exonic
1185697062 X:2203149-2203171 GCTGCGTTTCATCACCATTTGGG - Intergenic
1189195539 X:39149118-39149140 GCTCCTTCAGATCACCATGGAGG + Intergenic
1189497266 X:41520596-41520618 CCTCCATCTCATCACCATTTAGG - Exonic
1191902142 X:66052594-66052616 GCTGCTGCTCATCTCCATTTTGG + Intergenic
1192079768 X:68035946-68035968 TTTGCTTTTCATCAGCATGTGGG + Intergenic
1192901660 X:75505376-75505398 TCTGCTCCTCACCACCATCTTGG - Intronic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic
1195785819 X:108521572-108521594 TCTGCTTTACATCACCTTGTGGG + Intronic
1198671056 X:139081348-139081370 ACTCCTTCTCATCTCTATGTTGG + Intronic
1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG + Intergenic