ID: 1032618703

View in Genome Browser
Species Human (GRCh38)
Location 7:133503820-133503842
Sequence GTGGTTTGGGGGAGGGTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032618695_1032618703 -2 Left 1032618695 7:133503799-133503821 CCTATGTGTGTTATGTGTTGGGT 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1032618703 7:133503820-133503842 GTGGTTTGGGGGAGGGTACGTGG 0: 1
1: 0
2: 2
3: 22
4: 299
1032618692_1032618703 26 Left 1032618692 7:133503771-133503793 CCTAAGCGTATGAATTAGGGATT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1032618703 7:133503820-133503842 GTGGTTTGGGGGAGGGTACGTGG 0: 1
1: 0
2: 2
3: 22
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032618703 Original CRISPR GTGGTTTGGGGGAGGGTACG TGG Intronic
900569771 1:3352437-3352459 GTGGGCTGGGGGAGGGGACACGG + Intronic
900658267 1:3770787-3770809 GTTGTCTGGGGGAGGGGAGGAGG + Intronic
900680789 1:3915131-3915153 GAGGTTTGGGGGAGGACAAGCGG + Intergenic
901239789 1:7686278-7686300 ATGGTCTGGGAGAGGGTACCAGG + Intronic
901656659 1:10773390-10773412 GTGGGCTGGGGGAGGGGGCGGGG + Intronic
902768332 1:18631368-18631390 GAGGTTGGGGGGAGGGAAGGTGG - Exonic
903041094 1:20531269-20531291 GTGGTTTGGAGGAGGATGCTGGG - Intergenic
903524221 1:23980531-23980553 CAGGCTTGGGGGAGGGTAAGAGG - Intronic
903582252 1:24380300-24380322 GTAATTTGGTGGAGGGTAGGAGG - Intronic
903661729 1:24982587-24982609 GTGTTTTGGGGGGTGGTCCGTGG + Intergenic
903671366 1:25037775-25037797 GTGGGGTGGGGTAGGGTAGGAGG - Intergenic
904564674 1:31421561-31421583 CTAGTTTGGGGGAGAGTAAGAGG + Intronic
905461531 1:38125914-38125936 GTGGAGTGTGGGAGGGGACGGGG + Intergenic
905800723 1:40840497-40840519 CTGGTTTGGGGGTGGGGACAAGG + Intergenic
906120729 1:43388896-43388918 GTTGGTTGGGGGAGGGAAAGGGG - Intronic
908360955 1:63367856-63367878 GTGGGTCGGGTGAGGGGACGCGG + Intronic
908655964 1:66389206-66389228 GTGGTTTAAGGGAGGGTTGGGGG + Intergenic
908995090 1:70141996-70142018 GAGGGTTGGGGAAGGGTAAGAGG - Intronic
911503430 1:98717790-98717812 GTGGGTAGGGAGAGGGTAAGAGG + Intronic
912415059 1:109502467-109502489 GTGGTTTGGGGGAGGTGGTGAGG + Intronic
912473382 1:109921071-109921093 GTGGTGTGGAGAAGGGAACGGGG - Intronic
912955651 1:114152991-114153013 GCGGGGTGGGGGAGGGTATGAGG - Intronic
913498362 1:119448596-119448618 GTGGTTTGGAGGAGGATAAAGGG + Intergenic
914258802 1:145981731-145981753 GTGGTTTGAGGGAGGCTAAATGG + Intergenic
914829056 1:151157332-151157354 TTGGTTTGGGGGAGAGGGCGAGG + Intronic
915357408 1:155263766-155263788 GTGGTTTTGTGGAGGGAAGGAGG - Intronic
917975781 1:180236670-180236692 GTGGATGGGGGGCGGGTAGGTGG + Intronic
918271920 1:182910290-182910312 GGGGATTGGGGGATGGTAGGTGG - Intronic
920507020 1:206522534-206522556 ATGGTTTGGGGGAGGGTGCTGGG - Intronic
920632974 1:207670189-207670211 GTGGCTTGGGGTAGGGGACGAGG - Intronic
921973180 1:221173346-221173368 GTGGGGGGGGGGAGGGTACATGG + Intergenic
922558117 1:226548636-226548658 TTGGTTGGGGGGAGGGGGCGGGG + Intergenic
923092650 1:230751850-230751872 GTGGGGTGGGGGAGGGGAGGGGG + Intronic
923361628 1:233217684-233217706 GTGGTATGGGGGAAGGTGTGGGG - Intronic
923379889 1:233406370-233406392 GTGGTTTTGGGGAGGGTTTAAGG + Intergenic
923915646 1:238500852-238500874 GCGGTTTTGGCGAGGGTAGGGGG - Intergenic
1062866770 10:862457-862479 GTGGGGTGGGGGAGGGGACAGGG + Intronic
1062963765 10:1592438-1592460 GTGGCTTGGGCGAGGGTAGCTGG - Intronic
1062963815 10:1592627-1592649 GTGGCTTGGGCGAGGGTAGCTGG - Intronic
1063382211 10:5592564-5592586 GTGGTATGTGGGAAGGTTCGGGG + Intergenic
1064844722 10:19638977-19638999 GTTGTTTGGGGGTGGGAGCGGGG + Intronic
1066340609 10:34529282-34529304 GTGGTTTGGAGGAAGGGAAGAGG - Intronic
1067115713 10:43434276-43434298 GTGATTTTGGGGAGGGTCCAAGG + Intergenic
1069414459 10:68185445-68185467 GGGGTGTTGGGGAGGGTATGTGG - Intronic
1071456145 10:85853048-85853070 GTGATGTGGGGGATGGTGCGGGG - Intronic
1073110881 10:101062406-101062428 GTGTGTTGGGGGAGGCTACTTGG + Intronic
1076476040 10:130752097-130752119 TTGTTTTGGGGGAGGCTACCAGG - Intergenic
1076494620 10:130888973-130888995 GAGGTTTGGGGGAAGGGGCGGGG + Intergenic
1077092364 11:785037-785059 GGGGTTAAGGGGAGGGGACGGGG + Intergenic
1078362173 11:10677518-10677540 ATGGTTGAGGGGAGGGGACGGGG - Intronic
1078766946 11:14307181-14307203 TTGGTTTGGGGGAGGGGGCAGGG - Intronic
1078809850 11:14747691-14747713 GTGTATTGGGGGAGGGAAGGAGG + Intronic
1078966183 11:16346541-16346563 GTGGATTGGGGGAGAGGAGGTGG - Intronic
1079812539 11:25013218-25013240 GTGAGTTGGGGGAGGGGAGGAGG + Intronic
1082835875 11:57649802-57649824 GTGGGTGGGGGGAGGGTAGTTGG + Intronic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083659497 11:64245648-64245670 GGTGTTTGGGGGAGGGGAGGGGG - Intronic
1083827697 11:65212505-65212527 GTGGTTTGGGGGAAGGAAGAGGG + Intergenic
1084546975 11:69819440-69819462 TTGGTCTGGGGGAGGGGGCGGGG - Intergenic
1084575339 11:69985316-69985338 GTGGCTTGCGGGAGGGAACCCGG + Intergenic
1087781587 11:102306453-102306475 TTGGGGTGGGGCAGGGTACGCGG - Intergenic
1090918272 11:131186245-131186267 GAGGTTTGGGGGATGGTGGGGGG - Intergenic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091610513 12:2004099-2004121 GGGGTTTGGGGGAAGGAAGGCGG - Intronic
1091971583 12:4791925-4791947 GTGGTTTGGGGGAGCTTTTGTGG + Intronic
1092928064 12:13290188-13290210 GTGGTTTGGAGGAGGATCCAGGG + Intergenic
1093737739 12:22641207-22641229 GTGATTTGGGGGAGGGTTCGAGG + Intronic
1093868780 12:24261486-24261508 GTGGCTTTGGGGTGGGTAGGTGG - Intergenic
1094155300 12:27332571-27332593 GTGGGTTAGCGGAGGGCACGGGG - Intergenic
1094317367 12:29148991-29149013 GTGGTTTGGGGGAGGGGAGTTGG - Intergenic
1095237497 12:39815588-39815610 CTAGTTTGGGGGACGGTAAGAGG + Intronic
1096982871 12:55738387-55738409 GTGTTCCGGGGGAGGGTATGAGG - Intergenic
1099058632 12:77877786-77877808 GTGGTGTGGGGGTGGGAAGGAGG + Intronic
1101999431 12:109547684-109547706 GGGGTTTGGGGGAGGGTTCAAGG - Intergenic
1102101470 12:110281605-110281627 GTTGTCTGGGGGAGGGGGCGCGG + Intronic
1103334242 12:120177341-120177363 GTGGTAGGGGGGAGGGAAGGGGG - Intronic
1103446304 12:120997355-120997377 GTGGTTTGGAGGAGGGGGCAGGG - Intronic
1104557818 12:129817785-129817807 GTGGTTTGGGGGTGTGTGGGGGG + Intronic
1107482330 13:40795126-40795148 GTGGCATGGGGGAGGGGAGGGGG - Intronic
1107552578 13:41491077-41491099 GTGGAGTGGGGGAGGGGGCGCGG + Intergenic
1107869550 13:44734555-44734577 GTGGTTTGGGGCAGGGTTCCAGG - Intergenic
1108061652 13:46539080-46539102 GAGGTTTGGGGGAAGGAAGGGGG - Intergenic
1113325494 13:109277566-109277588 GTTGTTAGGGGCAGGGTAAGGGG + Intergenic
1113508649 13:110833878-110833900 GTGGTTTGCGGGAGGCCACCAGG + Intergenic
1113993780 14:16050848-16050870 GTGGGGTGGGGGAAGGTAGGAGG + Intergenic
1115521770 14:34239978-34240000 CTAGTTTGGGGCAGGGTAGGGGG + Intronic
1116193649 14:41692557-41692579 GTGGTGTGGGGGAAGTTAGGAGG - Intronic
1116995397 14:51318641-51318663 GTGGTTTGGGGGAGGCTGCTGGG + Intergenic
1119753751 14:77098951-77098973 GTGGTTAGTGGGTGGGTTCGGGG + Intronic
1119931163 14:78548825-78548847 GTGGTTTGGGAGAAGGGACCTGG - Intronic
1121168876 14:91836511-91836533 GTGGTGTGGGAGTGGGTACGGGG - Intronic
1121472756 14:94168042-94168064 GTGGGTGGGGGGACGGTGCGTGG - Intronic
1122226538 14:100284072-100284094 GTGGTTTGGAGGAGGCCACTGGG - Intergenic
1122688824 14:103522173-103522195 GTGGCCTGGGGGAGGGGGCGCGG + Exonic
1122981497 14:105194241-105194263 GTGGTCTGGGGGCGGGTTCCAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124190292 15:27569258-27569280 GTGGTTTGGGGATAGGTAGGAGG - Intergenic
1125267451 15:37899705-37899727 GTGGTTTGGTAGAGGGGACATGG - Intergenic
1126767136 15:52019886-52019908 GTGGGATGGGGGAGGAGACGCGG - Intronic
1127258066 15:57307884-57307906 GGGGTTTGGGGCAGGGGACACGG + Intergenic
1128086743 15:64891889-64891911 GTTGTCTGGGGGAGGGGACAGGG - Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1128322080 15:66701357-66701379 GTGGGTTGGGGGCGGGATCGGGG - Intergenic
1129064463 15:72889463-72889485 GAGGTATGGGGGAGGGGGCGCGG - Intergenic
1129154448 15:73709222-73709244 GTGGGCTGGTGGAGGGTAGGTGG + Intronic
1129910350 15:79221432-79221454 GAGGTCTGGGGCAGGGTCCGGGG - Intergenic
1130225432 15:82054500-82054522 GTGGGTTGGGGAAGGGAACAAGG - Intergenic
1131371674 15:91887049-91887071 GTGTTTTGTGGGAGGGCACAGGG + Intronic
1131848786 15:96515943-96515965 GTGCTTTAGGGGAGGGGAAGAGG - Intergenic
1133821067 16:9237058-9237080 GTGATTTGGTGGAGGGTTTGAGG - Intergenic
1135748517 16:25037632-25037654 GTGATTTGGGGGAGGGTCCAGGG + Intergenic
1135751789 16:25064275-25064297 GTGATTTGGGGGAGGGTCCAGGG - Intergenic
1135758304 16:25116174-25116196 GTGATTTGGGGGAGGGTCAAGGG + Intronic
1138941407 16:61794944-61794966 GTGGTATGGGGGTGGGGAGGAGG - Intronic
1140029655 16:71325300-71325322 GTGATTTGGGGGAGGATTCAAGG - Intergenic
1140695690 16:77531074-77531096 GTGATTTGGGGGAGGCTTCAAGG - Intergenic
1142335755 16:89489411-89489433 GGTGTTAGGGGGAGGGTAGGCGG - Intronic
1143622842 17:8090938-8090960 GTGGTGTAGGGGAGGGAAAGGGG + Intergenic
1144282506 17:13740447-13740469 ATAGTTTAGGGGAGGGTTCGTGG - Intergenic
1148591344 17:48818505-48818527 GTGGGATGGGGGAGGGGACCAGG - Intergenic
1148765853 17:50037795-50037817 GTGGGCTGGGGGAGGGATCGGGG + Intergenic
1149755400 17:59181808-59181830 GTGGTTTGGGGTTGGGGTCGGGG - Intronic
1152245368 17:79182522-79182544 GGGCGTTGGGGGAGGGGACGGGG - Intronic
1156875617 18:42006816-42006838 GGTGTGTGGGGGAGGGTAGGTGG + Intronic
1157473812 18:48008865-48008887 GTTGTTCGGGGGTGGGTACAGGG - Intergenic
1157546534 18:48550475-48550497 GTGGTTTGGGGAGGGGAAGGTGG - Intronic
1157700938 18:49761361-49761383 GGGGTGTGGGGGGGGGTATGGGG - Intergenic
1158258908 18:55587216-55587238 GGGGGTTGGGGGTGGGGACGTGG + Intronic
1160059516 18:75516419-75516441 GTGCTTGGGGGTAGGATACGGGG + Intergenic
1160497436 18:79383626-79383648 GTGGACTGGGGCAGGGTCCGGGG - Intergenic
1160822804 19:1066283-1066305 GGGGGTTGGGGGAAGGTAGGAGG + Intronic
1161315465 19:3615315-3615337 GTGGTGTGGGGCAGAGCACGCGG - Intronic
1162070565 19:8149703-8149725 GCGGCTCGGGGGAGGGTCCGGGG + Exonic
1162648129 19:12064905-12064927 GAGACTTGGGGGAGGGTAGGCGG + Intronic
1162771340 19:12951137-12951159 TTGGTTTGGGGGCTGGTAGGTGG + Intronic
1163158725 19:15452569-15452591 GTGGTTTGGGGGGGGGGGGGAGG + Intronic
1163215307 19:15871895-15871917 CTGGTTTGGGGGATGGTGCCAGG - Intergenic
1163529567 19:17841820-17841842 GTGGCTTGGGGGTGGGTTCATGG - Intronic
1164364635 19:27563068-27563090 GTGGGGTGGGGGAGGGGAGGGGG + Intergenic
1165157462 19:33796828-33796850 GTGGGTGGGGGGAGGGTTGGGGG + Intronic
1166343626 19:42152405-42152427 GAGGTTTGGGGGAGGGCAGCCGG - Intronic
1166356520 19:42230512-42230534 GAGGTCTGGGGGAGGGGAGGGGG + Exonic
1166970570 19:46564493-46564515 GTGGCTTGGGTGAGGGTAGGGGG + Intronic
1168173733 19:54608090-54608112 GTGGGTTTGGGGAGGGTCCCTGG - Intronic
926728511 2:16016657-16016679 GGGGGTTGGGGGAGGGGACAGGG - Intergenic
926822632 2:16869937-16869959 ATGGTTTGGGGCAGGGTGCCAGG - Intergenic
927662942 2:25008271-25008293 GTGGTTTGGGGGAGTGTCCTAGG + Intergenic
928096266 2:28406940-28406962 GTGGCTTGTGGGTGGGTACATGG + Intronic
928503142 2:31919270-31919292 GTAGGTTGGGGGAGGGCATGGGG - Intronic
929429986 2:41878761-41878783 GTGGGTTGGGGGATGGGAGGAGG - Intergenic
930027554 2:47038631-47038653 GTGGGTGGGGGGAGGGTGGGTGG - Intronic
930674839 2:54189328-54189350 GTGGTTAGGTGGAGGGTGAGGGG - Intronic
930861980 2:56083793-56083815 GTGGTTTGGGGGTAGGTCAGGGG + Intergenic
931937460 2:67214648-67214670 GTGTTTTGGGGGGGTGTATGTGG - Intergenic
932752040 2:74377405-74377427 GTGATTTGGGGGTGGGAATGGGG - Intronic
933655882 2:84886645-84886667 GTGATTTGGGGGAGAGTTCAAGG - Intronic
933723441 2:85412544-85412566 GTAGTTTGGTGGAGGGTGGGAGG + Intronic
934651862 2:96097054-96097076 GGGGCTTGGGGGAGGGGAAGTGG + Intergenic
934702006 2:96449939-96449961 GTGGTTTGGGGCAGCTTTCGTGG - Intergenic
936477597 2:112853071-112853093 GTGGGGTGGGGGGTGGTACGGGG + Intergenic
938069360 2:128300349-128300371 CTGGTTTGGGAGAGGGTGGGTGG - Intronic
939547400 2:143570276-143570298 GTGGTTTGGGGGGAGGTTCCAGG - Intronic
940292769 2:152093863-152093885 GAGTTTTGGGGGAGGTTAGGAGG + Intronic
941806873 2:169718573-169718595 GTTGTTAGGGGGAGGGTGCTAGG - Intronic
943636365 2:190311268-190311290 GGGGTTTGGGGGACGGAAGGAGG + Intronic
948144410 2:235697574-235697596 ATTGGTTGGGGGAGGGTCCGTGG - Intronic
948382919 2:237563666-237563688 CTGGCTTGGGGGAGGGCACCTGG + Intergenic
1168911010 20:1446716-1446738 GTGGTTTGGAGGAGAGAAGGCGG - Intronic
1171127842 20:22620005-22620027 GTGGGTTGGGGGAGGGGAATGGG + Intergenic
1172118149 20:32583797-32583819 GTGGCGTGGGGGAGGGGGCGGGG - Intronic
1172419122 20:34798639-34798661 GTTGTTTGGGAGAGAGTAAGAGG + Intronic
1172625364 20:36343613-36343635 GGGGGTTGGGGGGGGGTACCTGG - Intronic
1174708576 20:52682065-52682087 GGTGCTTGGGGGAGGGTACCTGG + Intergenic
1175160347 20:57003558-57003580 GAGGTTTGGAGGAGGGGAGGAGG + Intergenic
1175771427 20:61627061-61627083 GTGTTTTGGAGGAGGGTGGGTGG + Intronic
1176180292 20:63746700-63746722 GTGAGTTGGGGGAGGGCACAGGG - Exonic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177104155 21:16933819-16933841 TTGGTTGGGGGGAGGGTCCCTGG - Intergenic
1178386141 21:32152066-32152088 GTGGCATGGGGGAGGGGAGGTGG + Intergenic
1178924335 21:36762365-36762387 GTGGGTGGAGGGAGGGTGCGGGG + Intronic
1180187199 21:46145730-46145752 GCTGTTGGGGGGAGGGCACGGGG - Intronic
1180313488 22:11256665-11256687 GTGGGGTGGGGGAAGGTAGGAGG - Intergenic
1180693832 22:17739537-17739559 GTGGTGTGGGAGAGGGTATCAGG - Intronic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1182352464 22:29706566-29706588 GGGGGCTGGGAGAGGGTACGGGG + Intergenic
1182386210 22:29943762-29943784 GGGGTTTGGGGGTGGGGAAGGGG - Intronic
1183614363 22:38934378-38934400 GTGGTGTGGGGCAGGGGATGGGG - Intergenic
1185279658 22:49964624-49964646 GGGGTTTGGTGGAGGGTATCGGG + Intergenic
1185430480 22:50807818-50807840 CTGGTTTGGGTTAGGGTTCGGGG + Intergenic
950471666 3:13190157-13190179 GGGGTTGGGGGGAGGGTTCTTGG - Intergenic
952169668 3:30792852-30792874 TTAGTTTAGGGGAGGGTATGTGG - Intronic
953019683 3:39105532-39105554 GTGGTTAGGGGGAGGGCTCTGGG - Intronic
953087372 3:39683140-39683162 GTGGTTAGGAGAAGGGTACTAGG + Intergenic
953610248 3:44441784-44441806 ATGGATTTGGGGAGGGTACATGG - Exonic
956044994 3:65186230-65186252 GGGGTTTGGGGGTGGGGATGAGG - Intergenic
958990644 3:100840104-100840126 GTGGTTTTAGGGCGGGGACGGGG + Intronic
959432656 3:106274063-106274085 GGGGTTAGGGTGAGGGTATGAGG - Intergenic
960954649 3:123023630-123023652 GGGTTTTGGGGGAGGGTGAGAGG - Intronic
961046336 3:123711194-123711216 GTGGTGTGGGGCAGGGGACGGGG + Intronic
961384251 3:126515614-126515636 GGGGGTTGGGGGATGGTAGGTGG - Intronic
961384264 3:126515645-126515667 GGGGTTAGGGGGAGGGTAGGTGG - Intronic
961384278 3:126515677-126515699 GGGGGTTGGGGGAGGGTAAGTGG - Intronic
961384303 3:126515742-126515764 GGGGTTGGGGAGAGGGTAGGTGG - Intronic
961384316 3:126515774-126515796 GGGGGTTGGGGGAGGGTAAGTGG - Intronic
961384341 3:126515839-126515861 GGGGTTGGGGAGAGGGTAGGTGG - Intronic
961384354 3:126515871-126515893 GGGGGTGGGGGGAGGGTAGGTGG - Intronic
961384560 3:126516440-126516462 GTGATGAGGGGGAGGGTAGGTGG - Intronic
962334862 3:134519014-134519036 GTGGTGGGGGGGTGGGTACATGG - Intronic
962941056 3:140125131-140125153 GTGGGTTGAGGGAGGATAGGGGG + Intronic
964284817 3:155106652-155106674 GTGGTTGGGGGGATGGTGGGAGG + Intronic
965382388 3:168005947-168005969 GTGTTTCCGGGGAGGGTAGGTGG + Intergenic
967372606 3:188764778-188764800 CTGGTTTGGGGGAGGATCCTTGG - Intronic
968310685 3:197681036-197681058 GGGGATGGGGGGAGGGGACGGGG + Intronic
968599807 4:1503610-1503632 GCGGTTTGGGTGAGGGTGTGGGG - Intergenic
971677955 4:29659330-29659352 GTGCTTTTGGGGAGGGTGGGAGG - Intergenic
972161582 4:36234396-36234418 GGGGTTTGGGGGAGGTTATTAGG - Intronic
976139335 4:81974342-81974364 GTGGTTTGGGGAAGAGAAGGGGG - Intronic
976629935 4:87225709-87225731 GTAGTTTGGGGGTGGGTCTGTGG + Intronic
977451509 4:97204815-97204837 GTGGATTGGGGGAGGGATGGGGG - Intronic
980920636 4:139083175-139083197 GAGGTTTGGGGGGGGGTAGAGGG + Intronic
981226004 4:142294946-142294968 GTGGTGTGGGGAAGGGAAAGAGG + Intronic
981616276 4:146647893-146647915 GCGGTTTGGGAGAGGGTGAGGGG + Intergenic
981683840 4:147430845-147430867 GGGGTTTGGGGGAGGTCATGAGG + Intergenic
982263914 4:153521028-153521050 GTGATTTTGGGGAGGGGAAGTGG + Intronic
982844521 4:160232865-160232887 GAAGTTTGGGGGAGGGTTAGAGG + Intergenic
983092009 4:163514983-163515005 GGGGTTTGGTGGGGGGTAGGTGG + Intronic
983260559 4:165451907-165451929 GGGGTTGGGGGGGCGGTACGTGG - Intronic
984912219 4:184684714-184684736 GTGGCTTGGGGGAGTATACCAGG + Intronic
985700115 5:1366028-1366050 GTGGGTAGGGGGCGGGTAAGGGG + Intergenic
986846019 5:11754421-11754443 GTTTTTTGGGGGAGGGGGCGGGG + Intronic
988967327 5:36432353-36432375 GTGGATGGGGGGAGGGGAGGGGG + Intergenic
990501665 5:56402481-56402503 GTGGCTTGGCGGAGTGTAAGCGG + Intergenic
990798604 5:59573421-59573443 GGGGTATTGGGGAGGGTACAGGG - Intronic
992205776 5:74429283-74429305 GGGGTTTGGAGGAGGGTCCTGGG - Intergenic
992624565 5:78625493-78625515 CAGGTTTGGGGGTGGGTAGGAGG - Intronic
993927851 5:93893343-93893365 GCATTTTGGGGGAGGGTAGGGGG - Intronic
995524493 5:113039707-113039729 GTGGGTTGGGGGGGGGGGCGCGG - Intronic
995791966 5:115898572-115898594 GTGGTTTGGTGGTGGGGATGGGG + Intronic
996729432 5:126703118-126703140 GAGGTTTGGGGGAGGTCACAAGG + Intergenic
997283169 5:132661196-132661218 GTGGGTTGGAGGAGGGGACTGGG + Intergenic
997684928 5:135781917-135781939 GTGGTTGGGGGGAGGGGTGGAGG + Intergenic
999093600 5:148958605-148958627 GTGGTTTGTGGGAGGGAGGGGGG + Intronic
999665278 5:153906341-153906363 GGAGTTTGGGGGAGGGTGCTGGG - Intergenic
1002866852 6:1129490-1129512 GGGGTTTGGGGGGTGGGACGTGG + Intergenic
1005417705 6:25619338-25619360 AAGGTTTGGGGGAGGGGAGGGGG - Intronic
1007631517 6:43275720-43275742 GTGGGGTGGGGCAGGGGACGCGG - Intronic
1008627869 6:53335487-53335509 GTGGGGTGGGGGAGGGGATGAGG - Intronic
1009857970 6:69288962-69288984 TTGGGTTGGGGGAGGGTTGGGGG - Intronic
1009969525 6:70612304-70612326 GTGGTGTGGAGGTGGGTAGGGGG - Intergenic
1010729724 6:79378042-79378064 GTGTTTTGGGGGAGGGGAAAGGG + Intergenic
1012549541 6:100454504-100454526 GTGGTAGGGGGGTGGGTAGGGGG - Intronic
1015787095 6:136929519-136929541 AAGGTTTGGGGGAGGGGAAGTGG + Intergenic
1015835659 6:137417519-137417541 GTAGTTTTGGGGAGGATACTTGG - Intergenic
1016561765 6:145403375-145403397 GTGGTTGGGGGGAGGGGGTGTGG - Intergenic
1017199935 6:151741940-151741962 GTGGTTATGGGGAGGGTTGGGGG - Intronic
1019873610 7:3789913-3789935 GGGGGTTGGGGGCGGGTAGGGGG + Intronic
1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG + Intergenic
1022092812 7:27118483-27118505 TAGCTTTGGGGGAGGGTAGGTGG + Intronic
1023591027 7:41780724-41780746 GTGGTTTGGGGGATGGTTTTGGG - Intergenic
1024633366 7:51267225-51267247 GGGGTTTGGGAAAGGGTACCAGG - Intronic
1026012262 7:66645831-66645853 GTGGTGTGGTGGAGGGTCAGGGG - Intronic
1027355147 7:77347132-77347154 GGGGTATGGGGGAAGGGACGTGG - Intronic
1029634360 7:101774035-101774057 GTGGTTTGGAGCAGGGTAGGAGG + Intergenic
1032094175 7:128929381-128929403 GGGGTTTGGTGGAGGCCACGTGG - Intergenic
1032618703 7:133503820-133503842 GTGGTTTGGGGGAGGGTACGTGG + Intronic
1033120830 7:138665038-138665060 GTGGTTGGGGGAAGGGTCGGGGG - Intronic
1033441219 7:141380994-141381016 GTGGTTATGGGGTGGGTACGGGG - Intronic
1033982273 7:147179979-147180001 GTTGTTTGAGGGAGGGTATCAGG + Intronic
1034152653 7:148929081-148929103 GGGGTTTGGGGGTGGGAAGGAGG - Intergenic
1034299521 7:150002932-150002954 GTGGTGTGGGTGTGGGTAGGGGG - Intergenic
1034460704 7:151196387-151196409 GGGTTATGGGGGAGGGTACAGGG + Intronic
1034806482 7:154093841-154093863 GTGGTGTGGGTGTGGGTAGGGGG + Intronic
1035125262 7:156604500-156604522 GTGCATTGGTGGAGGGAACGTGG - Intergenic
1036691961 8:10949793-10949815 GTTGGGTGGGGGAGGGTACGAGG + Intronic
1036707181 8:11054758-11054780 CTGGTGTGGGTGAGGGTCCGAGG + Intronic
1037899648 8:22680257-22680279 GGGGTTTGGGGAGGGATACGGGG - Intergenic
1038427909 8:27476804-27476826 CTGATTTGGGGCAGGGAACGAGG + Intronic
1041748933 8:61238064-61238086 GAGGTGTGGGGCAGGGTAGGAGG - Intronic
1042705130 8:71658934-71658956 GTGGTTTGGAGGTGGGCACATGG - Intergenic
1043383883 8:79730309-79730331 GTTGTTTGGGGGAGGTTTGGTGG - Intergenic
1043794270 8:84516004-84516026 GTGGTCGGGGGCAGGGTAGGGGG + Intronic
1045454954 8:102368617-102368639 GTGGGGTGGGTGAGGGTAGGGGG + Intronic
1049214807 8:141402677-141402699 GAGGTATGGGGGAGGGGAAGAGG - Intronic
1049300475 8:141866934-141866956 GTGGTTGGGGGGAGTGGACAGGG + Intergenic
1049554858 8:143276828-143276850 GTGGGTTGGGGGCAGGTAGGAGG - Exonic
1049598038 8:143493416-143493438 GTGGTTTGGGGTAGGGAAGAGGG - Intronic
1049646172 8:143736780-143736802 CTGGGGTGGGGGAGGGTACTGGG - Intergenic
1049795037 8:144493327-144493349 GAGGTTTGGGGGAAGGTTTGTGG + Intronic
1049944223 9:579182-579204 GTGGGTCGGGGAAGGCTACGTGG - Intronic
1050750336 9:8930102-8930124 GTGGTGTGGGGGGGGGTGGGAGG - Intronic
1051021695 9:12552677-12552699 GTGGTTTGGGGGAGGTAATTAGG - Intergenic
1051102519 9:13537294-13537316 CTGCTTTGGGAGAGGGTAAGTGG + Intergenic
1051671233 9:19512647-19512669 GAAGTATGGGGGAGGGTAGGCGG + Exonic
1052999561 9:34570178-34570200 GTGGTTTGGGGCAGTGTCCCCGG - Intronic
1054923724 9:70566983-70567005 GAGGTTTGGGAGAGGGAACAAGG + Intronic
1057055097 9:91954419-91954441 GAGGTTTGGGGCAGGGTTTGGGG - Intergenic
1058089572 9:100789449-100789471 GGGGTGTGGGTGAGGGTAGGTGG + Intergenic
1059199582 9:112401712-112401734 GTGGGGTGGGGGAGGGAAGGAGG + Intronic
1059284627 9:113161983-113162005 GAGATTTGGGGGAGGGTGGGTGG - Intronic
1060119212 9:120972529-120972551 GTGGTTTGGGGTGGGGTACCAGG - Intronic
1060742072 9:126105552-126105574 TTGGGTAGGGGGAGGGTAAGAGG - Intergenic
1060799824 9:126536936-126536958 GTGGTTTGGGGGTGGGGATATGG - Intergenic
1062150818 9:135018264-135018286 GTGGCTTGGGGGAGGGCCCGTGG - Intergenic
1062362860 9:136195749-136195771 GGGGTTGGGGGGTGGGGACGGGG + Intergenic
1062388864 9:136326233-136326255 GGTCTTTGGGGGAGGGCACGTGG + Intergenic
1189182602 X:39018093-39018115 GGGGTTTGGGGGAGGGTGGGTGG - Intergenic
1189458464 X:41216324-41216346 GTGTTTTGGTGGAGAGTACATGG + Exonic
1190213631 X:48466629-48466651 GTGGTCTGGGGGTGGGTTCTGGG + Intronic
1190606168 X:52145469-52145491 GTGGGTGGGGGGAGGGGACAGGG - Intergenic
1191041518 X:56086140-56086162 GTGATTTGGGGACGGGTACAAGG + Intergenic
1193103583 X:77643092-77643114 CTGGTTTGTGGGAGGATACTGGG - Intronic
1194715074 X:97278483-97278505 GGGGTTAGGGGGAGGGAAGGAGG - Intronic
1195046469 X:101058884-101058906 GTAGTTTGGGGGAAGGTGTGGGG - Intergenic
1195116448 X:101703690-101703712 GAGGTTTGGGGGAGGGGAGTGGG + Intergenic
1197299725 X:124763260-124763282 GTGGCTTGGGCAATGGTACGAGG + Intronic
1197774626 X:130111003-130111025 GCGGGGTGGGGGAGGGAACGAGG + Intergenic
1197962972 X:132025066-132025088 GGGGTGTGGGGCAGGGTGCGTGG - Intergenic
1198061301 X:133047668-133047690 GTGGTTTGGGGGAGGTGATTAGG + Intronic
1198178118 X:134175045-134175067 GTGGTCTGGGGGAGGGGACGGGG - Intergenic
1199599935 X:149535852-149535874 GTGGGTTGGAGGAGGGAAGGAGG - Intergenic
1199601246 X:149542402-149542424 ATGGGTTGGTGGAGGGTACACGG + Intronic
1199649131 X:149937082-149937104 ATGGGTTGGTGGAGGGTACACGG - Intronic
1200098024 X:153673292-153673314 GGGGTGCGGGGGAGGGTGCGTGG - Intronic
1201332496 Y:12840289-12840311 GTGTTTTGGTGGAGAGTACATGG + Exonic