ID: 1032621804

View in Genome Browser
Species Human (GRCh38)
Location 7:133541882-133541904
Sequence CACCCCTCACTCATGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032621804_1032621812 23 Left 1032621804 7:133541882-133541904 CCCTGTGTCATGAGTGAGGGGTG 0: 1
1: 0
2: 6
3: 27
4: 142
Right 1032621812 7:133541928-133541950 AGAGGCTGAAGTCCCATTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 164
1032621804_1032621808 -9 Left 1032621804 7:133541882-133541904 CCCTGTGTCATGAGTGAGGGGTG 0: 1
1: 0
2: 6
3: 27
4: 142
Right 1032621808 7:133541896-133541918 TGAGGGGTGGGTGTCCAGTGAGG No data
1032621804_1032621813 26 Left 1032621804 7:133541882-133541904 CCCTGTGTCATGAGTGAGGGGTG 0: 1
1: 0
2: 6
3: 27
4: 142
Right 1032621813 7:133541931-133541953 GGCTGAAGTCCCATTTGTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1032621804_1032621810 5 Left 1032621804 7:133541882-133541904 CCCTGTGTCATGAGTGAGGGGTG 0: 1
1: 0
2: 6
3: 27
4: 142
Right 1032621810 7:133541910-133541932 CCAGTGAGGAATTCCAGCAGAGG 0: 1
1: 0
2: 3
3: 22
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032621804 Original CRISPR CACCCCTCACTCATGACACA GGG (reversed) Intronic
902708164 1:18220860-18220882 CACCTCTCACTCATCATCCAGGG - Intronic
904364639 1:30002537-30002559 CACCCCTCAAACCTGACACTGGG + Intergenic
904407112 1:30299553-30299575 CACCCCTTGCTTCTGACACAAGG - Intergenic
905813889 1:40932845-40932867 GTCTCCTCACTCATGAAACAGGG + Intergenic
906058689 1:42934706-42934728 CTCACCTCACACATGACCCAGGG - Intronic
906246212 1:44276135-44276157 CATCCCTCACTCCTGCCCCAGGG + Intronic
906934427 1:50199837-50199859 CATCCCTCACAAATTACACAAGG + Intronic
910873410 1:91855348-91855370 CACCCCTCTCACCTGGCACAAGG + Intronic
917693214 1:177490350-177490372 CACCCCTCACCCATGCCATATGG + Intergenic
921178375 1:212612643-212612665 CAGTTCTGACTCATGACACAGGG + Intronic
921936620 1:220802012-220802034 CACCCCGCTCTGAGGACACATGG + Intronic
922537256 1:226390407-226390429 CACCCTTCACTCTTGACTCCTGG + Exonic
923088891 1:230723033-230723055 CACCTCCCTCTCTTGACACATGG - Intergenic
923488644 1:234462138-234462160 AACGCTTCACTCATGACACTAGG + Intronic
1062854964 10:775480-775502 CAGCCCTCACGCTGGACACAGGG - Intergenic
1063017600 10:2094326-2094348 CAGCCCTCACAAATGACAGATGG - Intergenic
1069716113 10:70522595-70522617 CAGCCCTCACTCATGACCAAAGG + Intronic
1069957496 10:72060974-72060996 CACCACTCACCCAGCACACAGGG + Exonic
1070191066 10:74112505-74112527 GACCCCTCACTGATGGCTCAGGG + Intronic
1071008923 10:80914929-80914951 CACCACTCCCTCATAACACTAGG - Intergenic
1071583743 10:86798894-86798916 CACCACTGACTACTGACACAAGG - Intronic
1072741314 10:97911617-97911639 CACCCCTCACTGATGCCATAGGG + Intronic
1073977835 10:109120265-109120287 CAGGTCTCTCTCATGACACATGG - Intergenic
1074134647 10:110615962-110615984 CACCATTTACTCAGGACACAGGG + Intergenic
1077390170 11:2297145-2297167 GACCCCTCACTGGGGACACAGGG + Intronic
1083782643 11:64926088-64926110 CAGCCCTCTCTGCTGACACATGG + Intronic
1084394462 11:68899656-68899678 AACCTCTCACACAGGACACAGGG + Intronic
1088881285 11:113975365-113975387 CTCCCCACACTCCTGGCACAGGG + Exonic
1089596906 11:119586314-119586336 CCCCCCCCACCCATGCCACACGG + Intergenic
1090144292 11:124303303-124303325 CACCTCCCTCTCTTGACACACGG + Intergenic
1096711784 12:53462860-53462882 CACCCCACACACATAAAACATGG - Intronic
1098144836 12:67487801-67487823 CACGTCCCTCTCATGACACATGG + Intergenic
1098656335 12:73034893-73034915 CACCTCACAATCATGACAGAAGG + Intergenic
1102970814 12:117164728-117164750 TACCCCTCTCTAATGACACAGGG + Intronic
1104397302 12:128445456-128445478 AACCCCTGACCCATCACACACGG - Intronic
1104467653 12:129003862-129003884 CACCGCTCACTCCTGTCACAGGG - Intergenic
1106807379 13:33324368-33324390 CAGCCCTCACTCCTGGCATAAGG - Intronic
1108455959 13:50613845-50613867 CACCCATCACTCAGGAAAGAGGG + Intronic
1109365759 13:61354509-61354531 CACCTCCCTCTCTTGACACAGGG - Intergenic
1110339025 13:74367240-74367262 CCCACCTCACTCATGACTCTTGG - Intergenic
1111600247 13:90463924-90463946 AACTCCTCACTCAGGGCACAAGG - Intergenic
1112286424 13:98108458-98108480 CAGCCCTCACTCACGTCATAAGG + Intergenic
1116858812 14:49977594-49977616 CAACCATCTCTCATGACATATGG - Intergenic
1117500339 14:56344850-56344872 CACCTCTCTCCCTTGACACATGG - Intergenic
1120972059 14:90215835-90215857 CTGCCCCCACTCTTGACACATGG + Intergenic
1121052656 14:90829724-90829746 CACCCCTCACTGTAGAAACAAGG - Intergenic
1202838724 14_GL000009v2_random:100364-100386 CAACCCTCACTGATGACACAGGG + Intergenic
1202908083 14_GL000194v1_random:90435-90457 CAACCCTCACAGATGACACAGGG + Intergenic
1123439788 15:20282049-20282071 GACCCCTCACCCATCACACCTGG + Intergenic
1125497868 15:40214487-40214509 AACACCTCACCCAAGACACAGGG - Intronic
1127601527 15:60542629-60542651 CACACCTCACACACGACACACGG + Intronic
1127601531 15:60542655-60542677 CACCTCACACACATGGCACACGG + Intronic
1127842148 15:62840845-62840867 CACCCCTCTCTCCTGAGACACGG - Exonic
1128960361 15:71997008-71997030 CACCCCAGACTTATGACCCATGG + Intronic
1133027939 16:2996796-2996818 CTCCCCTCACTCATGAGGCAGGG - Intergenic
1138499084 16:57427487-57427509 CACCCCTCTCGCTTGACACGTGG - Intergenic
1138661899 16:58525218-58525240 CATCACTCACTCAGCACACATGG - Exonic
1143296622 17:5876244-5876266 CACCCCTCACCAATGACAGGTGG + Intronic
1143673552 17:8413430-8413452 CACCCAACCCTCATGCCACAGGG - Intronic
1143909853 17:10238841-10238863 CACAGCTTACTCATGACATAGGG + Intergenic
1144753889 17:17668102-17668124 CACCCCTCCCTCCTTACACCTGG + Intergenic
1148330924 17:46813503-46813525 CACCCCTCATTCCTAACTCAGGG - Intronic
1148993865 17:51690510-51690532 CAGGCCTCTCCCATGACACATGG - Intronic
1151527142 17:74678312-74678334 AACCCCTAACTGATGACACCAGG + Intronic
1152919770 17:83060244-83060266 CTCCCCTCACTGCTGGCACACGG + Intergenic
1155985655 18:32227948-32227970 CACCTCCCACCCTTGACACATGG - Intronic
1156346001 18:36257704-36257726 CACCCAGCTCTCATGCCACAGGG + Intronic
1159654635 18:71018160-71018182 GACCCTTCTCTCTTGACACAGGG - Intergenic
1160044279 18:75372248-75372270 CGCCCCACAGTCATGTCACATGG - Intergenic
1161080912 19:2309714-2309736 CACCCCTCACTTGGGACAAATGG - Intronic
1161833191 19:6625201-6625223 AAACCCTTACTCCTGACACATGG + Intergenic
1162913940 19:13864687-13864709 CACAGCTCACACAAGACACACGG - Intronic
1163815107 19:19460379-19460401 CGCCCAACACTCAAGACACAAGG - Intronic
1163978222 19:20872992-20873014 CACCACTCACTCATCACAGTGGG + Intergenic
1163980730 19:20897319-20897341 CACCCCTCACTCATCACAATGGG + Intergenic
1164670052 19:30067330-30067352 CACCCCTGGCTCAAGGCACAGGG + Intergenic
1168281781 19:55309823-55309845 CAGCCCTCATTCCTGAGACACGG + Intronic
1202634307 1_KI270706v1_random:30217-30239 CAACCCTCACAGATGACACAGGG - Intergenic
1202651571 1_KI270707v1_random:9813-9835 CAACCCTCACTGATGACAGAGGG + Intergenic
925418702 2:3692866-3692888 CAGCCCTGACTCATGGGACAGGG - Intronic
928458547 2:31448241-31448263 CTCCCCTCACCAAAGACACAAGG - Intergenic
930025302 2:47025817-47025839 CACTCCTCACTCCTGACCCCAGG + Intronic
933598882 2:84309444-84309466 CAGTCCTCACCCATGACTCATGG - Intergenic
941413061 2:165184616-165184638 TACCACTCATTCCTGACACAGGG - Intronic
946231331 2:218292654-218292676 GACGCCTCACTAATAACACAGGG + Intronic
946907057 2:224427736-224427758 CACAGATCACACATGACACATGG - Intergenic
948707124 2:239801779-239801801 CACCCCTCAGTCATCTCACAAGG - Exonic
948835485 2:240624205-240624227 CATCCCTCACTCTGGCCACAGGG - Intronic
1168938599 20:1689901-1689923 AGCCCTGCACTCATGACACAAGG + Intergenic
1173414987 20:42847289-42847311 CAACCTTCAGTCAAGACACACGG + Intronic
1174858101 20:54065780-54065802 CACCCCTCACTTCTCAGACACGG - Intronic
1175945878 20:62558523-62558545 CACCCAGCACTCCTGAAACAGGG - Intronic
1176600575 21:8789834-8789856 CAACCCTCACTGATGACACAGGG - Intergenic
1176627443 21:9105112-9105134 CAAACCTCACAGATGACACAGGG + Intergenic
1176646522 21:9355988-9356010 CAACCCTCACAGATGACACAGGG - Intergenic
1177676488 21:24307879-24307901 CAGTCCTCACTCATGACAGAAGG + Intergenic
1178734758 21:35138856-35138878 AAGCCCTCAGTCAAGACACAGGG - Intronic
1179494747 21:41764435-41764457 CCCCTCTCACCCCTGACACACGG - Intronic
1179959996 21:44762762-44762784 CACCCCTCTCTCCTCCCACAGGG - Intergenic
1180342858 22:11681372-11681394 CAACCCTCACTGATGACACAGGG - Intergenic
1180366395 22:11943010-11943032 CAACCCTCACAGATGACACAGGG + Intergenic
1180417788 22:12784711-12784733 CAACCCTCACTAATGACACAGGG + Intergenic
1181459837 22:23079399-23079421 CATCCCTCACTCTTAACTCAGGG - Intronic
1181462876 22:23095631-23095653 CACCTCTCCCTCTTGCCACAGGG - Exonic
1181641561 22:24202941-24202963 CACACCTCACTCTTGTTACATGG + Intergenic
1182905126 22:33929312-33929334 CACCCAACACTCATCACATATGG + Intergenic
1183026383 22:35068591-35068613 GACCTCTCTCTCATGACACAGGG - Intronic
953092518 3:39743463-39743485 CATCCCCCATTCATGACAGAGGG - Intergenic
953366489 3:42350009-42350031 CAACCATCACTCAGGAGACAAGG + Intergenic
954640538 3:52095284-52095306 CAGCCCCCAGTCATGACACCTGG + Intronic
954803336 3:53200361-53200383 CACTGCTGACTCATGACTCAGGG - Intergenic
957871031 3:86090728-86090750 CACCCATCCCTTATGGCACATGG + Intergenic
959105040 3:102056031-102056053 CTGCCCTCACTCATCACCCAGGG + Intergenic
960583229 3:119298004-119298026 CACCCCTCACTGGCTACACAGGG + Intronic
962674153 3:137741245-137741267 CTCCACTCACTCATGAAACATGG + Intergenic
962967719 3:140370060-140370082 CACCTGTCACTCATGACTAATGG - Intronic
965488151 3:169304061-169304083 CACCCCTCATGCATGAGAGATGG + Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
1202740361 3_GL000221v1_random:49051-49073 CAACCCTCACAGATGACACAGGG + Intergenic
968977006 4:3827349-3827371 GACCCCTCCCTAAGGACACACGG - Intergenic
969697650 4:8744185-8744207 CACACATCACTCCTGACACCTGG - Intergenic
971829106 4:31666874-31666896 CACTCCTCACTGATTACATAAGG - Intergenic
972744414 4:41919714-41919736 CACCCCTCACCCAGGACATTTGG - Intergenic
973175814 4:47203656-47203678 CAACCCTCATTTGTGACACAGGG + Intronic
973364006 4:49192582-49192604 CAACCCTCACTGATGACACAGGG - Intergenic
973397076 4:49604161-49604183 CAACCCTCACTGATGACACAGGG + Intergenic
974219600 4:58949055-58949077 CAGGCCTCTCTCATGACACATGG + Intergenic
975189797 4:71446884-71446906 AATCCCTCACTTATCACACAGGG - Intronic
976117069 4:81739261-81739283 CACCCCTAACCCCTGACCCAAGG + Intronic
976956302 4:90904599-90904621 CTTCCTCCACTCATGACACATGG - Intronic
981279459 4:142940663-142940685 CACCCCTCATTCATCACTAATGG + Intergenic
1202761317 4_GL000008v2_random:113688-113710 CAACCCTCACAGATGACACAGGG - Intergenic
990969530 5:61488368-61488390 CCTCCCTAACTCATTACACAAGG - Intronic
995600441 5:113790007-113790029 CGCATCTCACCCATGACACATGG - Intergenic
999776712 5:154817792-154817814 CACGTCTCACTTAAGACACAGGG - Intergenic
1002353039 5:178598226-178598248 CACCTCTCTCCCTTGACACATGG - Intergenic
1002484464 5:179524697-179524719 CACCCTTCACACAAGCCACATGG + Intergenic
1004053959 6:12115695-12115717 CAACCCTCTCTCCTTACACAGGG - Intronic
1004966791 6:20861086-20861108 CAGTCCTGACTCATGAAACATGG - Intronic
1005190246 6:23213559-23213581 AACGCCTCACTCATGGCACAAGG + Intergenic
1007528777 6:42521620-42521642 CACCCCTTAATCATGGCATAAGG - Intergenic
1007782671 6:44263445-44263467 CCCCCCTCACTAATGCCCCAAGG - Intronic
1012108757 6:95199014-95199036 CAGGTCTCTCTCATGACACATGG - Intergenic
1012540196 6:100353803-100353825 CACTCCTCACCCATGACTCATGG + Intergenic
1013182646 6:107731233-107731255 CTCTCCTCACTTAGGACACAAGG + Intronic
1019505447 7:1388291-1388313 CACCCTTCACCCTTCACACAGGG + Intergenic
1024300608 7:47884811-47884833 CTTCCCTCACTCATGACAGCTGG + Intronic
1028337855 7:89679631-89679653 CTGGCCCCACTCATGACACATGG + Intergenic
1031522985 7:122789052-122789074 CACCCATCACTGAGGACATAAGG - Intronic
1031810111 7:126357145-126357167 CATCCCTCAATGATGGCACATGG + Intergenic
1032621804 7:133541882-133541904 CACCCCTCACTCATGACACAGGG - Intronic
1038089239 8:24235296-24235318 CACATCTCTCCCATGACACATGG + Intergenic
1038240675 8:25805505-25805527 CACCCCACTCTCATCAGACATGG + Intergenic
1038315153 8:26478079-26478101 CACCTCTCACCCTTGACGCATGG - Intronic
1039239939 8:35545444-35545466 CACCCCTTCCTCATCCCACAGGG - Intronic
1040591062 8:48792462-48792484 CAGCCCTCACACATGTCAGAAGG - Intergenic
1041684778 8:60633292-60633314 TACCCCTCACAGATGACAGAAGG - Intergenic
1043423620 8:80125898-80125920 CACCCCAGAATCATCACACACGG + Intronic
1047695202 8:127396461-127396483 CATCCTTCACTCATGAAATAGGG + Intergenic
1055468796 9:76591364-76591386 ATCCACTCACTCATGACCCAGGG + Intergenic
1056808189 9:89744632-89744654 CACTCCTCAGTCATCACCCAGGG + Intergenic
1057900302 9:98943440-98943462 CACCCTGCACGCCTGACACATGG - Intronic
1059345409 9:113624920-113624942 CATCACTCAGACATGACACACGG + Intergenic
1059677324 9:116551688-116551710 CACACATCACTCATAACCCATGG + Intronic
1060284497 9:122236883-122236905 CACCCTCCACGCATCACACATGG + Intergenic
1060960140 9:127674960-127674982 CCTTCCTCACTCATGAAACATGG + Intronic
1061580843 9:131535012-131535034 CACCCCTTACTCCTCACCCAGGG + Intergenic
1062726523 9:138077178-138077200 CACTCCTCACTGATGACAGCCGG - Intronic
1203750286 Un_GL000218v1:72799-72821 CAACCCTCACAGATGACACAGGG + Intergenic
1203709004 Un_KI270742v1:79006-79028 CAACCCTCACAGATGACACAGGG + Intergenic
1203542087 Un_KI270743v1:98570-98592 CAACCCTCACAGATGACACAGGG - Intergenic
1187308980 X:18122624-18122646 CACCCCTCACACACAACCCAAGG - Intergenic
1198274140 X:135085589-135085611 CACCCCTCCTTCATTCCACAGGG - Intergenic
1200243066 X:154507860-154507882 GGCCCCTCCCTCCTGACACAGGG - Exonic
1200955365 Y:8938658-8938680 CACCCCTCCTCCATGACACCTGG + Intergenic
1201163939 Y:11190447-11190469 CAACCCTCACAAATGACACAGGG + Intergenic