ID: 1032621899

View in Genome Browser
Species Human (GRCh38)
Location 7:133542626-133542648
Sequence GGGGAGAATAGGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032621887_1032621899 21 Left 1032621887 7:133542582-133542604 CCAGCCTTGGGCAAGAGGGATTC 0: 1
1: 28
2: 83
3: 161
4: 356
Right 1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG No data
1032621888_1032621899 17 Left 1032621888 7:133542586-133542608 CCTTGGGCAAGAGGGATTCTAGT 0: 1
1: 50
2: 128
3: 169
4: 305
Right 1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032621899 Original CRISPR GGGGAGAATAGGACTGAGGA GGG Intronic
No off target data available for this crispr