ID: 1032621899 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:133542626-133542648 |
Sequence | GGGGAGAATAGGACTGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1032621887_1032621899 | 21 | Left | 1032621887 | 7:133542582-133542604 | CCAGCCTTGGGCAAGAGGGATTC | 0: 1 1: 28 2: 83 3: 161 4: 356 |
||
Right | 1032621899 | 7:133542626-133542648 | GGGGAGAATAGGACTGAGGAGGG | No data | ||||
1032621888_1032621899 | 17 | Left | 1032621888 | 7:133542586-133542608 | CCTTGGGCAAGAGGGATTCTAGT | 0: 1 1: 50 2: 128 3: 169 4: 305 |
||
Right | 1032621899 | 7:133542626-133542648 | GGGGAGAATAGGACTGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1032621899 | Original CRISPR | GGGGAGAATAGGACTGAGGA GGG | Intronic | ||
No off target data available for this crispr |