ID: 1032626874

View in Genome Browser
Species Human (GRCh38)
Location 7:133600784-133600806
Sequence TGTAAGCTAGAACTCTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032626874 Original CRISPR TGTAAGCTAGAACTCTGCAC CGG (reversed) Intronic
900195080 1:1371887-1371909 TGCAGGCTAGGACTCTGGACAGG + Intergenic
903396890 1:23008354-23008376 TGAAAGCTAGATCTCTGGAGAGG - Intergenic
907871801 1:58450304-58450326 TGAAATCTAGAACCATGCACTGG + Intronic
909139997 1:71851532-71851554 TATAAGCTCCAACTATGCACAGG + Intronic
916097575 1:161364923-161364945 CGTATGCTAGAACTCTGGGCAGG - Exonic
919283009 1:195517134-195517156 TGTAAGCCAGATATATGCACAGG + Intergenic
920770526 1:208880782-208880804 AGTAGGCTGGAAATCTGCACTGG + Intergenic
924019142 1:239762160-239762182 GGTAAGCTAGATTTCTGCTCTGG - Intronic
1065167932 10:23000177-23000199 TGTAAGCTCCAACTCTGTCCAGG + Intronic
1072216043 10:93288040-93288062 TTTAAGCTAGAAATCTGGGCTGG - Intergenic
1072671666 10:97434568-97434590 TCTGATCTAGAATTCTGCACAGG - Intergenic
1075263623 10:120982790-120982812 TGTTTGCTAGAATCCTGCACTGG - Intergenic
1079195465 11:18322714-18322736 TGGAAGCTACAACTCTAGACAGG - Exonic
1079512477 11:21227742-21227764 TGTCAGCAAGAAATGTGCACAGG - Intronic
1079674599 11:23210103-23210125 TGTAAGGTGGAACTCTTCACAGG + Intergenic
1079679374 11:23274693-23274715 TCTAAGCTAAAATTCTGCATAGG + Intergenic
1082669459 11:56016711-56016733 TGTAAAGTTGAACTATGCACTGG + Intergenic
1083314775 11:61807807-61807829 GGTGAGCTAGAGCTCTGCTCAGG - Intronic
1088111532 11:106267279-106267301 TGACAGCTTGCACTCTGCACTGG + Intergenic
1099593410 12:84625372-84625394 TTTAAGCAAGAACTCTGTGCCGG - Intergenic
1099904029 12:88750844-88750866 TGTAAGACAGAATTCAGCACAGG + Intergenic
1100106672 12:91183536-91183558 TGTAAACTAGAACTTTGAAAAGG + Intergenic
1104346608 12:128005295-128005317 AGTAAGCTGGGACCCTGCACAGG - Intergenic
1106718256 13:32413559-32413581 TGTTAGCCAGACCTCTCCACTGG + Intronic
1108892810 13:55282102-55282124 TTTAAGATAGAATTCTGGACTGG + Intergenic
1113627448 13:111857473-111857495 TGGAATCTGGAACTCTGCTCTGG + Intergenic
1114539187 14:23442412-23442434 GGGAAGCTAAACCTCTGCACTGG - Intergenic
1115170038 14:30494430-30494452 TGAAAACTAGCACTCTGCATTGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116475930 14:45339378-45339400 TGTATGGCAGAACTCTTCACAGG + Intergenic
1121367776 14:93330855-93330877 TGTAACCTAGAAATCAACACAGG + Intronic
1124804556 15:32868396-32868418 TCTACGCTACAAATCTGCACAGG - Intronic
1132790161 16:1681637-1681659 GGAAAGCTAGAGCTCTGCACAGG - Intronic
1132966347 16:2657536-2657558 TGGAAGCTGGAACTCAGTACAGG - Intergenic
1136317142 16:29460987-29461009 TGAAAGCAAAAACTCTGCAAAGG + Intronic
1136431717 16:30200329-30200351 TGAAAGCAAAAACTCTGCAAAGG + Intronic
1137978712 16:53052617-53052639 TGTAATCTAGGACTTTGCCCAGG + Intergenic
1140025321 16:71284473-71284495 TCTAAAATAGAACTCTGCCCAGG + Exonic
1140188840 16:72797252-72797274 GTTAAGCTGGAACTCAGCACTGG + Exonic
1141264569 16:82484808-82484830 TGTAATCTAGAAAACTGAACGGG - Intergenic
1145078007 17:19870947-19870969 GGTAAACTAGAAATCTGCCCTGG - Intergenic
1147813294 17:43189219-43189241 TATAAGCTACCACTCTTCACCGG - Intronic
1152004093 17:77666764-77666786 CATTAGCTAGAACTCTGGACAGG - Intergenic
1160663910 19:313982-314004 TCTAAGCAAGGACTCTGCAGAGG + Intronic
1162273180 19:9632884-9632906 GGTAAGATAGAAATTTGCACTGG - Intronic
1163311542 19:16517854-16517876 TGTAAGTCAGAAGTGTGCACGGG - Intronic
1164414258 19:28033156-28033178 TGTTAGCTTGACCTCTGCCCAGG - Intergenic
1164509821 19:28888341-28888363 TGTGAGCCGGAACTCTGCCCAGG - Intergenic
1166684667 19:44789144-44789166 TGTAGGCGAGATCTCAGCACTGG - Intronic
926062160 2:9811470-9811492 TTTAAGCTAAAACTCAGGACTGG + Intergenic
926526840 2:13991897-13991919 TGACAGCTTGAACTGTGCACTGG - Intergenic
926668777 2:15554554-15554576 TGAAAGCTAGAATTGGGCACAGG + Intronic
928482382 2:31695337-31695359 AGCAAGCTAGAAGTTTGCACAGG - Intergenic
929031819 2:37656529-37656551 TGCTAGCTAGTACTCTTCACAGG - Intronic
932862695 2:75311228-75311250 TGTCACCAAGAACTCTGCTCTGG + Intergenic
936501332 2:113068986-113069008 TCTAAGCTGTAACTCTACACTGG + Intronic
936886318 2:117314646-117314668 TGAAAGCTGGAATTCTCCACAGG + Intergenic
938355848 2:130648186-130648208 TGTAATCTAGAAATGTGCAAAGG + Intronic
944052075 2:195481057-195481079 TGGAGGCTACAACTCTGCAATGG - Intergenic
1172835152 20:37868686-37868708 TGTAAGCGAGGCCTCGGCACAGG + Intronic
1175499195 20:59437600-59437622 GCTAAGATAGAACACTGCACCGG - Intergenic
1175610144 20:60344310-60344332 TGGAAGCCAAGACTCTGCACTGG - Intergenic
1175768587 20:61608158-61608180 TCTAGGCTAGAACTCCGCAGCGG - Intronic
951322270 3:21259725-21259747 GTTAAGCTGGGACTCTGCACTGG - Intergenic
951980170 3:28557042-28557064 TGAAAGCTAGAATTCTACAAGGG - Intergenic
954072341 3:48152027-48152049 TGCAAGCAGGAACTCTGGACTGG + Intergenic
955155972 3:56416948-56416970 TCTAACTTAGATCTCTGCACCGG - Intronic
963838709 3:150082598-150082620 TGTGATCTAGAAGTATGCACCGG - Intergenic
968851737 4:3085089-3085111 TGTAATCAAGCAATCTGCACGGG - Intronic
970247769 4:14081206-14081228 TTAAAGCTAGCACTCTGCTCTGG - Intergenic
971431380 4:26571681-26571703 AGTAAGACAGACCTCTGCACTGG - Intergenic
979677308 4:123424029-123424051 TGTAAGCTCAAATTATGCACAGG - Intergenic
985626543 5:991844-991866 TGTACGGTGGAATTCTGCACTGG - Intergenic
986107823 5:4677075-4677097 TTTCAGCTAGAACTCTGCAAAGG - Intergenic
987037288 5:14031354-14031376 TGTATGGTAGAACACTGCTCTGG - Intergenic
996477598 5:123938564-123938586 TGCAAGCTGGAAGTTTGCACAGG - Intergenic
1002557249 5:180052328-180052350 TGTTAGCCAGAACTCTACACTGG - Intronic
1006051783 6:31350900-31350922 AGTAAGCTGGAAGTTTGCACGGG - Intronic
1008484720 6:52023604-52023626 TGTAAACTAGAAATGTGGACTGG - Intronic
1011411966 6:87075319-87075341 AGTAGTCTAGGACTCTGCACAGG - Intergenic
1012262492 6:97103673-97103695 TGTAACCTAGTTCTCTGCATTGG + Intronic
1013079559 6:106800570-106800592 TGGAAGGTAGGACTCAGCACAGG - Intergenic
1019420722 7:949532-949554 TGTGAGCTAGACCTCAGCTCTGG - Intronic
1023068742 7:36406047-36406069 TGCATGCTAGAACTTTTCACTGG + Intronic
1023211025 7:37804927-37804949 GGCAAGCTAGAAGTTTGCACGGG + Intronic
1024505250 7:50157115-50157137 TGTAATCGAGAAAACTGCACTGG + Intronic
1031870689 7:127087200-127087222 TCTAAGCTGGAACCCTGCAGTGG - Intronic
1032626874 7:133600784-133600806 TGTAAGCTAGAACTCTGCACCGG - Intronic
1038983731 8:32786501-32786523 AGCAAGCTAGAACCTTGCACAGG - Intergenic
1043035052 8:75186318-75186340 TGTAAACTATAACTTTGCAAGGG - Intergenic
1044301613 8:90591068-90591090 AGTAAGCTAGAAGCTTGCACAGG + Intergenic
1045034314 8:98165549-98165571 TGGGAACTAGAATTCTGCACAGG - Intergenic
1057102607 9:92377124-92377146 AGCAAGCTAGAAGTTTGCACAGG - Intronic
1058622237 9:106895738-106895760 TGAAAGCTAGCAATCAGCACAGG - Intronic
1060459771 9:123839704-123839726 TGTAAGGTGGAACTCTTCACAGG - Intronic
1060755955 9:126213682-126213704 TGTAAGTTAGAAATCTGGATGGG + Intergenic
1192153406 X:68725943-68725965 GGTAAGCTAGGACTCAGCAGAGG - Intergenic
1194131904 X:90091828-90091850 TGTAACCTAGTACTCTGTAGGGG - Intergenic
1196301269 X:114052007-114052029 TGGAAGATAGCATTCTGCACGGG - Intergenic