ID: 1032626886

View in Genome Browser
Species Human (GRCh38)
Location 7:133601069-133601091
Sequence ATATAAACAAAGGGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032626886_1032626892 13 Left 1032626886 7:133601069-133601091 CCCAGCTTCCCCTTTGTTTATAT 0: 1
1: 0
2: 0
3: 23
4: 324
Right 1032626892 7:133601105-133601127 AAATTGAGGAATAAGTTGTTTGG No data
1032626886_1032626891 -1 Left 1032626886 7:133601069-133601091 CCCAGCTTCCCCTTTGTTTATAT 0: 1
1: 0
2: 0
3: 23
4: 324
Right 1032626891 7:133601091-133601113 TGCTGCTTTTTAAAAAATTGAGG 0: 1
1: 4
2: 16
3: 104
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032626886 Original CRISPR ATATAAACAAAGGGGAAGCT GGG (reversed) Intronic
900279835 1:1859629-1859651 ATGTAAAGAAAGGGGGAGCAGGG + Intronic
900373143 1:2341167-2341189 AGATCCACAAAGGGGAAGCTGGG - Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901560456 1:10066128-10066150 ATAGAAACAAAAGGGAAGGAAGG - Intronic
903881774 1:26515210-26515232 ATAAAAACAAGGGAAAAGCTGGG - Intergenic
905560809 1:38925720-38925742 ATATAAACAAAGAGAAAGTGGGG - Intronic
905776655 1:40672051-40672073 TTATAAAGAAAAGGGAGGCTGGG - Intergenic
906542707 1:46600150-46600172 ATGTAAACAAAGTGGGAGTTTGG - Intronic
907775913 1:57514726-57514748 GTATAGACAAAGGGTAGGCTGGG + Intronic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908488708 1:64621376-64621398 ATACAAAAAAAGGGGAAGAGGGG - Intronic
909387599 1:75077343-75077365 ATAAAAATAAAGGGGAGGCCAGG - Intergenic
909669339 1:78170490-78170512 ATATACACAAATGGAAAGATGGG - Intergenic
909687733 1:78369563-78369585 ATATTAACAAAAAGAAAGCTTGG + Intronic
910092855 1:83486255-83486277 ATCTAAACAGAGGGGAAACTGGG - Intergenic
910991699 1:93063366-93063388 ATATAGAAAAAGAGGGAGCTTGG - Intergenic
911780684 1:101873214-101873236 AGAGCAACAAAAGGGAAGCTTGG - Intronic
911848691 1:102786557-102786579 AGATAAATAAAGAAGAAGCTGGG - Intergenic
915044313 1:152999348-152999370 AAATAAACAGGGGTGAAGCTAGG + Intergenic
915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG + Intronic
916212313 1:162368903-162368925 ATATAATCTAAAGGAAAGCTAGG - Exonic
917080040 1:171248443-171248465 ATATAAACAACGGCTAACCTTGG + Intergenic
918067758 1:181113061-181113083 ATATAAATAAAGGGGGAGCCAGG - Intergenic
920240071 1:204540288-204540310 AAAAAAACAAAAGGGAAACTTGG + Intronic
921966958 1:221100260-221100282 TTACAAAGAAAGGGGAATCTTGG - Intergenic
923154287 1:231263574-231263596 ATATAAAAAAATGGAAAGCAGGG - Intronic
1064803498 10:19103579-19103601 AGAGAACCAAAGGGGAAGATGGG + Intronic
1064837807 10:19554359-19554381 ATAAAAAGAAAGAGCAAGCTTGG - Intronic
1065765110 10:29021910-29021932 AGTTAAACAGAGGGGAACCTAGG + Intergenic
1066706104 10:38179679-38179701 ATAGAAACAAAGAGCAAACTGGG + Intergenic
1067389759 10:45852411-45852433 ATATCAACAAAGTGAAAGATGGG + Intronic
1067501708 10:46811439-46811461 ATATCAACAAAGTGAAAGATGGG - Intergenic
1067592872 10:47528567-47528589 ATATCAACAAAGTGAAAGATGGG + Intronic
1067873506 10:49983634-49983656 ATATCAACAAAGTGAAAGATGGG - Intronic
1069437612 10:68399739-68399761 AGATAAACTAAAGGGAGGCTGGG + Intronic
1069502241 10:68964335-68964357 AAATTAACAAAGGGGGAGCATGG - Intronic
1069725607 10:70575946-70575968 ATATTCACAAAGGGGAGGCAAGG + Intergenic
1069976627 10:72218526-72218548 ATATATAAAATGGGGAAGTTGGG + Intronic
1069982919 10:72264794-72264816 ATATAACAAAGGGGGAAGCAGGG - Intergenic
1070136944 10:73702616-73702638 ATATCAACAAAGTGAAAGATGGG + Intergenic
1070530755 10:77335226-77335248 ATGAAAACAAAGGGAAACCTTGG + Intronic
1070558924 10:77551125-77551147 ATATAAAAATAGTGGTAGCTGGG - Intronic
1073041136 10:100607400-100607422 ATATTAACCAAAGGGAAGCTAGG + Intergenic
1074935316 10:118172977-118172999 ATATCAAGAAAGGAGAGGCTTGG - Intergenic
1075355043 10:121764244-121764266 ATTTAACAACAGGGGAAGCTGGG + Intronic
1075820068 10:125300184-125300206 ATAGAAAAAAAGAGGAATCTAGG + Intergenic
1079055226 11:17200313-17200335 ATTTAAACATAGGGGAAACTAGG + Intronic
1081288414 11:41301860-41301882 ATATCAACAATGGTGAATCTGGG - Intronic
1081952971 11:47061749-47061771 AAATAAACAAAACGGGAGCTAGG - Intronic
1083622134 11:64054451-64054473 ATATCAACAAAGTGGGTGCTGGG + Intronic
1085469464 11:76748126-76748148 GTGTAAACAAAGGGGCACCTGGG + Intergenic
1086190952 11:84078746-84078768 ATAAAAAGAAAAGAGAAGCTAGG - Intronic
1087943670 11:104131817-104131839 AAAAAAAAAAAGGGGATGCTTGG + Intronic
1088473072 11:110207567-110207589 ACAAAAACAGATGGGAAGCTGGG - Intronic
1088759868 11:112919200-112919222 TGATAAACAAAGGGGAAGCAAGG + Intergenic
1090050643 11:123375622-123375644 ATATGAATAAAGAGGAAGTTTGG + Intergenic
1091871627 12:3896016-3896038 ATATAAATGAGGGGGAAGGTGGG + Intergenic
1092596667 12:10013363-10013385 ATATAAACAAAGAGGAAGAGTGG + Intronic
1092934293 12:13346253-13346275 CTATAAGCAAATGGGAAGCTGGG - Intergenic
1097073557 12:56375153-56375175 ATAGAAACAAAGTGGAAGGGTGG + Intergenic
1097984061 12:65764760-65764782 AAAAAAAAAAAGGGGGAGCTGGG + Intergenic
1098114058 12:67155817-67155839 ATATGTCCAAAGGGGAAGCAGGG + Intergenic
1098904708 12:76150231-76150253 ATGTTAACAATGGGGAAGCTGGG - Intergenic
1099535458 12:83838181-83838203 ATAAAAACATATGGTAAGCTGGG + Intergenic
1100178060 12:92053148-92053170 ATATAAACAAGGGAGAAGAAAGG - Intronic
1100668141 12:96778018-96778040 ATAAAAACAAAAGGTAATCTAGG + Intronic
1102476784 12:113193902-113193924 GTGGAAACAAAGGGGAAGATGGG - Intergenic
1102676589 12:114663766-114663788 AAATGAACAAGGGGGAGGCTTGG - Intergenic
1102995740 12:117348988-117349010 ATATTAACATTGGGGAAACTAGG + Intronic
1106356888 13:28991770-28991792 CTTTAAACAAAGGGGAAGGAGGG - Intronic
1106504460 13:30359115-30359137 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1107054087 13:36084457-36084479 ATATAAACAAATTTGAAGTTTGG + Intronic
1107170716 13:37339805-37339827 ATATAAACAGAGGAGAAGGATGG - Intergenic
1108701107 13:52945057-52945079 AAAGGAGCAAAGGGGAAGCTGGG + Intergenic
1108769425 13:53680359-53680381 CCAGAAACAAAGGGGAAGTTTGG - Intergenic
1109283205 13:60380729-60380751 ATATAAACAAAGCAGGAGGTGGG - Intergenic
1110096739 13:71533932-71533954 ACATAAACACATGAGAAGCTTGG + Intronic
1110513388 13:76380405-76380427 TTATAAATAAAGGGGAAATTTGG + Intergenic
1111578298 13:90188602-90188624 AAATAAACAAAGGAGAAACAGGG + Intergenic
1112119504 13:96394283-96394305 ATACAAAAATGGGGGAAGCTGGG - Intronic
1112165091 13:96909771-96909793 ATAGAAACAAAGTGGAAGTGAGG + Intergenic
1114152833 14:20064143-20064165 AAAAAAAAAAAGGTGAAGCTGGG - Intergenic
1114388111 14:22276784-22276806 ATATACACAAAAGGGAAATTTGG - Intergenic
1115070520 14:29317028-29317050 ATTTAAACAAAGAAGAATCTAGG + Intergenic
1115553963 14:34529553-34529575 ATATAAATAAATGTGTAGCTTGG - Intronic
1115712197 14:36062641-36062663 GGATCAACAAAGGGGAAGCTGGG - Intergenic
1116370455 14:44123905-44123927 CTATATACAAAGGAGAATCTAGG - Intergenic
1118129991 14:62952108-62952130 ATAGAAACAAAGGAGTAGCAGGG + Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120516102 14:85472041-85472063 AAATACATAAAGGGGAATCTTGG - Intergenic
1121226984 14:92328349-92328371 ATCTCAACACAGGGAAAGCTAGG + Intronic
1121540502 14:94722485-94722507 AAAGAAAGAAAGGGGAGGCTGGG + Intergenic
1121570953 14:94946200-94946222 GTAAAAACAAAGGGGGTGCTGGG + Intergenic
1125310339 15:38372249-38372271 AAATAAACTAAGGGGGAGCAAGG - Intergenic
1126160850 15:45612074-45612096 TTATAATCAAAGGGGAGCCTAGG - Intronic
1126243902 15:46480526-46480548 ATGTTAACAATGGGGAAACTGGG - Intergenic
1126902752 15:53330833-53330855 AAATAAACAAATGGCATGCTGGG + Intergenic
1127135486 15:55918078-55918100 ATATAAAGAAATGTGCAGCTTGG - Intronic
1127491855 15:59472520-59472542 ACATAATCAACAGGGAAGCTGGG - Intronic
1127968227 15:63939772-63939794 GTATAAACAGAGGCTAAGCTGGG - Intronic
1128006698 15:64249140-64249162 ATATAAATAAATGGCAAACTTGG + Intronic
1128117696 15:65121346-65121368 AAATAAACAAAGTCGAAGCCAGG - Intronic
1129012592 15:72435878-72435900 ACATTAACAATGAGGAAGCTGGG - Intergenic
1129342530 15:74895592-74895614 AAAAAAAAAAAGGGAAAGCTCGG + Intronic
1129799701 15:78405135-78405157 ATATAAACCTTGGGGAGGCTGGG + Intergenic
1130749844 15:86699788-86699810 AACTATACAGAGGGGAAGCTTGG - Intronic
1131167009 15:90149516-90149538 ATGTAAACAAAGAGAAAGCCAGG - Intergenic
1131792783 15:95983217-95983239 ACCTAAACCAAGGGGAAGCAAGG - Intergenic
1133433266 16:5757140-5757162 ATATCGACCAAGGGCAAGCTTGG - Intergenic
1134064528 16:11219246-11219268 AGTTAAACAAATGGGAAGCCTGG - Intergenic
1134613985 16:15635480-15635502 AAAGAAACAAAGGGTAAGATGGG - Intronic
1136692758 16:32047557-32047579 ATATACACAGAGGAAAAGCTGGG - Intergenic
1136793252 16:32990782-32990804 ATATACACAGAGGAAAAGCTGGG - Intergenic
1136876600 16:33863275-33863297 ATATACACAGAGGAAAAGCTGGG + Intergenic
1137780692 16:51095620-51095642 ATAGAACCAAAGGGCAACCTTGG + Intergenic
1137971561 16:52990488-52990510 ATATACCCAAAGGGTATGCTGGG - Intergenic
1142168465 16:88606662-88606684 ATAAAAACGAAGAGGAAGCCTGG - Intronic
1203095511 16_KI270728v1_random:1252473-1252495 ATATACACAGAGGAAAAGCTGGG - Intergenic
1143019971 17:3912290-3912312 ATATAAATAAAAGGAAAGGTGGG - Intronic
1144395869 17:14842722-14842744 AAAGAAACAAAGGGGATGGTTGG - Intergenic
1144991933 17:19238729-19238751 TTAAAAATAAAGGGGAAGGTAGG - Intronic
1145062309 17:19740959-19740981 ATATAAACATAATGCAAGCTAGG - Intronic
1148281778 17:46353948-46353970 ATAGAAGGAAAAGGGAAGCTGGG - Intronic
1148304003 17:46571887-46571909 ATAGAAGGAAAAGGGAAGCTGGG - Intronic
1149288574 17:55193482-55193504 ATGAAAACAAAGGAGAAGCTTGG + Intergenic
1149387539 17:56156777-56156799 ATAAAAACAGAGGGCAAGCTAGG - Intronic
1150626328 17:66843589-66843611 GTTTAAACACAGGGGAAGATGGG - Intronic
1151615753 17:75209840-75209862 ATATAGATAAAGGGGCAACTTGG - Exonic
1152349924 17:79778599-79778621 GTGTAAACAAAGGGCAACCTCGG - Intronic
1153124770 18:1777801-1777823 GTAAGAACAAAGAGGAAGCTAGG + Intergenic
1154026932 18:10716736-10716758 GTAGACATAAAGGGGAAGCTTGG + Intronic
1154531050 18:15345343-15345365 ATAAAAACAAAAAGCAAGCTGGG + Intergenic
1155477376 18:26248222-26248244 TTATTAAAAAAGGGGAACCTAGG + Intronic
1155477465 18:26248871-26248893 TTATTAAAAAAGGGGAACCTAGG + Intronic
1156067631 18:33163985-33164007 CTATAAACCAAGTGGAAGCAGGG - Intronic
1156588328 18:38457701-38457723 ATATAAACTAAGAGGAAACAGGG - Intergenic
1156771330 18:40730342-40730364 ATATACACAGAGGAGAACCTGGG - Intergenic
1157346040 18:46834325-46834347 ATACAAATAAAAGGGAAACTGGG + Intronic
1158372300 18:56822000-56822022 ATAAAAACAAAGGAAAAACTGGG + Intronic
1159062091 18:63526274-63526296 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1159820631 18:73138232-73138254 ATATAAACACAGGCAAAGTTAGG + Intergenic
1160283962 18:77521747-77521769 ATATAGAGAAAGTGGAAGCAGGG + Intergenic
1160616984 18:80137895-80137917 ATATTGCCAAAGGAGAAGCTTGG + Exonic
1161176744 19:2847893-2847915 AGGTAAACCAAGGGGAAGCAGGG + Intronic
1161735816 19:5991599-5991621 AAAAAAAAAAAGGGGAACCTTGG - Intergenic
1164400254 19:27897254-27897276 AGAGGAGCAAAGGGGAAGCTGGG - Intergenic
1165179750 19:33957438-33957460 AAGAAAACAAAGGGGAAGTTTGG - Intergenic
1165236554 19:34426690-34426712 AAATAAAGAAAGGGGAAGACTGG - Intergenic
1165376806 19:35448784-35448806 AGAAAAGAAAAGGGGAAGCTGGG - Intronic
1167121951 19:47522497-47522519 TTAAAAACAAAAGGGAAGCTGGG + Intronic
924976228 2:178118-178140 ATGAAAACACAGGGGAACCTGGG + Intergenic
925871961 2:8279249-8279271 ATCCAAACGAAGGAGAAGCTTGG - Intergenic
927286948 2:21366911-21366933 ATATAAACAAAAGGGATCATTGG + Intergenic
927658862 2:24974914-24974936 ATATAAACACAGGCCCAGCTGGG + Intergenic
927707665 2:25306794-25306816 AGATAAACAAATAGGAAACTCGG + Intronic
927793326 2:26027974-26027996 AAATAAATAAATGGGAGGCTGGG - Intergenic
928492092 2:31794943-31794965 ATAGAAAGAAAGGGAAAGATAGG + Intergenic
928504264 2:31933377-31933399 ATATATAGAAAGGGGAAGAGAGG + Intronic
929407253 2:41656945-41656967 ATATAAACAGAGTGGATGCAAGG + Intergenic
930252599 2:49052282-49052304 ATAAGATCAAAGAGGAAGCTGGG - Intronic
930401804 2:50899498-50899520 ATATAAACCTGGGGGAAGCAGGG - Intronic
931823165 2:65972816-65972838 ATAAAAACTAAGGGCAGGCTGGG + Intergenic
932951202 2:76295758-76295780 ATAACAAAAAAGAGGAAGCTTGG + Intergenic
933364431 2:81332328-81332350 AGATAAATAAAAGGGCAGCTGGG + Intergenic
934632647 2:95945885-95945907 TTTTAAACAAAGGGGAAGGAGGG + Intronic
934800859 2:97157377-97157399 TTTTAAACAAAGGGGAAGGAGGG - Intronic
935667194 2:105523048-105523070 ATAAAAACTAAGGGGAGGCCGGG + Intergenic
935727340 2:106035218-106035240 ATAAAAACGAAGGGGGGGCTGGG + Intergenic
935807536 2:106763644-106763666 TTACAAACAAAGTGGAAGCAGGG - Intergenic
935934386 2:108166103-108166125 ATATAAACCAAGAAGAGGCTAGG - Intergenic
937675878 2:124589644-124589666 ATATTAGCACAGGGGAAACTGGG - Intronic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
940793854 2:158056277-158056299 ATATTAATAATGGGGAATCTCGG - Intronic
941649445 2:168078310-168078332 AGATGAACAAAGGAGAAGCATGG + Intronic
941766033 2:169297559-169297581 AAGTAAAGAAAGGGGAAGCAAGG - Intronic
944427380 2:199597475-199597497 ATATAAACAAATGGAGTGCTCGG + Intergenic
946042969 2:216798338-216798360 GAATGAAGAAAGGGGAAGCTGGG - Intergenic
946220473 2:218221620-218221642 ATATACACAATGAGGATGCTGGG - Intronic
946498008 2:220215712-220215734 ATAAAAACAGAGGGGAAGATGGG + Intergenic
947428112 2:230002166-230002188 ATGTCAACATGGGGGAAGCTGGG - Intronic
948327158 2:237133798-237133820 AAAAAAAAAAAGAGGAAGCTAGG - Intergenic
1170039455 20:12024680-12024702 ATTTAAAGAGAGGGGAATCTGGG - Intergenic
1170048723 20:12115477-12115499 ATAGAACCAGAGGGGAACCTGGG - Intergenic
1170729855 20:18964030-18964052 ATATTAATAAAGGGAAAACTGGG - Intergenic
1173471713 20:43328770-43328792 ATAAAAACAAACGGCAGGCTGGG - Intergenic
1174009216 20:47436133-47436155 ATAAAAATAAAGGGGAAGGTGGG - Intergenic
1174845666 20:53940811-53940833 ATACAAACACAGGGGAAACTAGG - Intronic
1174982635 20:55413937-55413959 ATGTTACCAAAGGGGAAACTGGG + Intergenic
1175505015 20:59476155-59476177 ATATAAAAAAAATGGAAACTTGG - Intergenic
1178691549 21:34754310-34754332 AAAAAAAGAAAGGGGAATCTCGG - Intergenic
1179662595 21:42886693-42886715 ATGTAAACAAATGTAAAGCTCGG - Intronic
1181425302 22:22833591-22833613 ATATAACCAAGGGAGAAGATGGG - Intronic
1183006682 22:34908777-34908799 ATATGAGCAAAGAGGATGCTGGG - Intergenic
1183262114 22:36802159-36802181 ATATTAACATCGGGGGAGCTGGG + Intronic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
1183722012 22:39568125-39568147 AAATAAACAAGGGGAAAGGTGGG - Intergenic
949174946 3:1049813-1049835 ATATACACAAGTGGGAAGGTGGG + Intergenic
951581475 3:24169189-24169211 ATATTGACAAAGGGGAAACTGGG - Intronic
951934830 3:28010906-28010928 ATTTAAACAAAGGGAAAATTTGG + Intergenic
952345538 3:32480602-32480624 ATATAATAAAGGGGGAGGCTGGG - Intronic
954838242 3:53490082-53490104 ATGTCATCAAAGGGGAAGCCAGG + Intergenic
955166595 3:56520944-56520966 ATATAACCAAAGAGGCACCTAGG + Intergenic
956634083 3:71345961-71345983 ATATAAGGAAAGGAGAGGCTTGG + Intronic
956969424 3:74505091-74505113 ATATGAAAAAAGGGGAAATTTGG - Intronic
958039905 3:88214482-88214504 AGATAATAAAAGGGAAAGCTTGG + Intergenic
958674969 3:97257315-97257337 ATGAAAATAAAGGGTAAGCTGGG + Intronic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
961171882 3:124802934-124802956 GTAGAAACAAAGGGCCAGCTCGG + Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962392087 3:134981014-134981036 ATATAAGCACAGGGCAAGCAGGG + Intronic
963130468 3:141853129-141853151 ACAGAAACAAAGGAGAAGCCAGG - Intergenic
963997241 3:151723918-151723940 ATTCAAACAAAGTGGAAGCTAGG - Intergenic
964517362 3:157527163-157527185 CTACAGACAAAGGGGAAGATTGG - Intronic
965238800 3:166164991-166165013 ATAGAAATAAAGGGGAAAATAGG - Intergenic
966399258 3:179531210-179531232 ATATAAATAAAAGGTAAGTTTGG - Intergenic
967091450 3:186138116-186138138 ATAGAAACAGAGTGGGAGCTGGG - Intronic
968146178 3:196300752-196300774 ATAGAAACAAGGGTGAGGCTGGG + Intronic
968271734 3:197408294-197408316 ATTTAAACTAGAGGGAAGCTTGG + Intergenic
969743778 4:9053827-9053849 ATTTCACCAATGGGGAAGCTGGG - Intergenic
971098977 4:23441245-23441267 GTATGAACTAAGGAGAAGCTGGG - Intergenic
971371419 4:26022412-26022434 ATAAAAACAGAGGAGAAGCCAGG + Intergenic
971573686 4:28246832-28246854 ATATTAACAAAAAGTAAGCTAGG + Intergenic
971797337 4:31244604-31244626 ATGTAGACAAAGGGGGAGGTGGG + Intergenic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
975642845 4:76517633-76517655 ATATATATAAAGGGGATGTTAGG + Intronic
978200828 4:106022126-106022148 ATATTCACAAAGGGGAGGCATGG - Intergenic
978445564 4:108776924-108776946 TTATAAAAAATGGGGCAGCTGGG + Intergenic
978807999 4:112820728-112820750 AGAAAAACAAAGGCAAAGCTAGG - Intronic
978873223 4:113606087-113606109 AAACAAACAAAAGGGAATCTTGG + Intronic
979571424 4:122230764-122230786 AAATATACAATGGGGAAGATGGG - Intronic
981050566 4:140305666-140305688 ATATAGACAGAGAGGAAGGTAGG + Intronic
981179799 4:141727252-141727274 ATATTAACAATAGGGAAACTGGG + Intronic
982992940 4:162302054-162302076 ATATAAATAAAATGGAGGCTGGG - Intergenic
983436056 4:167717203-167717225 ATATAAAATAATAGGAAGCTGGG - Intergenic
983586213 4:169357718-169357740 ATAAAAACAGATGGCAAGCTGGG - Intergenic
984115052 4:175669832-175669854 TTATAAAAAAAGGGGAAATTTGG + Intronic
985120684 4:186638382-186638404 AGATAAACAGATGGGAAGATAGG - Intronic
985154779 4:186975458-186975480 ATATGAAGAAAGGAGATGCTGGG + Intergenic
989383156 5:40829113-40829135 TTATACAGAAATGGGAAGCTTGG + Exonic
990433809 5:55767041-55767063 ATATCAAAAATGGAGAAGCTAGG + Intronic
992010173 5:72518094-72518116 GTTAAAAAAAAGGGGAAGCTTGG - Intergenic
992538081 5:77732248-77732270 CTATAAACAAATGGGTATCTGGG + Intronic
994150268 5:96439750-96439772 TGAGAAACAAAGGGGAAGTTAGG - Intergenic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997630252 5:135362297-135362319 ATGTTAACAATGGGGAAACTGGG + Intronic
1000022982 5:157334946-157334968 ATGTTAACAGTGGGGAAGCTGGG + Intronic
1001011517 5:168103289-168103311 ATGTGGACATAGGGGAAGCTGGG - Intronic
1001813351 5:174647504-174647526 ATAAAAACAAAGGGCAGGCCGGG + Intergenic
1003005737 6:2379793-2379815 ATCTATACAGCGGGGAAGCTGGG - Intergenic
1003784058 6:9463922-9463944 ATATGAACAAAGTGGAATTTGGG - Intergenic
1005116519 6:22344597-22344619 AGAGACACAAGGGGGAAGCTTGG - Intergenic
1005563017 6:27060737-27060759 ATCTAAGCAAAGGGAAAGTTTGG - Intergenic
1005911310 6:30312118-30312140 ATATAAGCAAAGGGAAATCCAGG + Intergenic
1006401549 6:33820801-33820823 GAAAAAACAAAGGGGAGGCTGGG - Intergenic
1007419356 6:41710370-41710392 AGATAAAGGAAGGGGAAGCCAGG + Intronic
1007828892 6:44622962-44622984 ATGTAAACAAAGGGCTAGCCTGG + Intergenic
1008110544 6:47488171-47488193 GTATAAATAAAGGGAAAGTTTGG + Intronic
1009262155 6:61506117-61506139 ATAAAAACTAAAAGGAAGCTAGG - Intergenic
1009316840 6:62229948-62229970 ATATAAATAAACTGGGAGCTGGG - Intronic
1009479527 6:64139673-64139695 AAATAAATAAATGGGAGGCTGGG + Intronic
1015716497 6:136197919-136197941 ATATCTACAAAGTGGAAGTTAGG + Intergenic
1019235762 6:170611081-170611103 ATATAAACAAACGTTAAGCCCGG + Intergenic
1019779170 7:2929624-2929646 AAATAAACATAAGGGAGGCTGGG + Intronic
1022161148 7:27712421-27712443 ATAGAAACAAAGGTCAGGCTGGG + Intergenic
1024010301 7:45260831-45260853 AGAAAAACAAAGGGAAAGCGAGG + Intergenic
1026166435 7:67914161-67914183 ATTTAATCAAAGAGGAATCTAGG + Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027309714 7:76942749-76942771 ATCTAAACAGAGGGGAAACTGGG - Intergenic
1027528798 7:79304312-79304334 TCATATACAAAGTGGAAGCTGGG + Intronic
1027617198 7:80437986-80438008 ATATTAACAATGAGGAAACTGGG + Intronic
1028367713 7:90053810-90053832 ATTTTTACAGAGGGGAAGCTTGG + Intergenic
1028414830 7:90568438-90568460 ATAGAAGGAAAGGGGAAGATAGG + Intronic
1029830966 7:103258747-103258769 ATATAAACAAAGGCCAAGTGGGG + Intergenic
1031128363 7:117801788-117801810 ATATAAACAACTGTGAATCTGGG + Intronic
1031319405 7:120304268-120304290 ATATATAGGAAGGGGAAGTTCGG + Intronic
1031638205 7:124127596-124127618 ATTTCAACTAAAGGGAAGCTTGG - Intergenic
1032252205 7:130267726-130267748 AAAGAAAGAAAGGGCAAGCTGGG - Intronic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1033093200 7:138405656-138405678 AGAGAAACAGAGGGCAAGCTGGG - Intergenic
1033931506 7:146528923-146528945 ATATCAAGAAAGCGGAAGCAAGG + Intronic
1034149994 7:148907776-148907798 ATGTTAACAATGGGGAATCTGGG - Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1036235381 8:7035311-7035333 ATATAGACAGACGGGAAGCAGGG + Intergenic
1036515079 8:9436555-9436577 ATATAAAGAAAGGTGAGGCCGGG + Intergenic
1037355950 8:18019726-18019748 GTTTAAATAAAGGTGAAGCTTGG + Intronic
1040452167 8:47558936-47558958 ATTTAAAAAACGGTGAAGCTGGG - Intronic
1040535698 8:48307687-48307709 TTATAAACAAACAGGAGGCTTGG - Intergenic
1041904451 8:63016437-63016459 ATAAAAACTTAGGGCAAGCTTGG + Intronic
1041947534 8:63462911-63462933 CTATAAACAAAGGCTTAGCTTGG + Intergenic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1043821337 8:84869023-84869045 ATATAAAGAAAGGGACAGATGGG + Intronic
1043865398 8:85369261-85369283 ATATAAATAAGGGGGTAGCAGGG - Intronic
1045014869 8:97992247-97992269 ATGTTAACAAAGGTGAATCTGGG + Intronic
1045434486 8:102147736-102147758 ATACTAATAAAGGGGAAACTGGG + Intergenic
1046257329 8:111718614-111718636 GTTTAAACAAAGGGAAATCTAGG + Intergenic
1046664939 8:116990764-116990786 ATGTTAACACAGGGGAAACTGGG + Intronic
1047963763 8:130030270-130030292 ATTTAAAAAATGGGGGAGCTAGG + Intergenic
1048711793 8:137220411-137220433 ATATATTCAAAGAGGAAGTTAGG - Intergenic
1050597214 9:7216031-7216053 ATAAAAGCAAAGAGGAGGCTGGG - Intergenic
1050641158 9:7669014-7669036 ATAAAAAGAAAAAGGAAGCTAGG - Intergenic
1051693284 9:19740701-19740723 ATATAACTCAATGGGAAGCTGGG + Intronic
1051892238 9:21954334-21954356 ATATTCATAAAGGGGAAACTGGG + Intronic
1052088458 9:24296612-24296634 ATTTTAACAATGGGGAAACTGGG - Intergenic
1055002220 9:71464639-71464661 ATGTTAACAATGAGGAAGCTTGG + Intergenic
1055826182 9:80327708-80327730 ATATTAATAATGGGGAAACTAGG + Intergenic
1055909911 9:81337611-81337633 ACATAAACAAAGGGAGATCTGGG + Intergenic
1058385998 9:104436665-104436687 ATATGAACAAAGGGGAAAAAGGG - Intergenic
1058930990 9:109718654-109718676 ATGTTAACAATGGGGAAACTAGG - Intronic
1059044278 9:110847886-110847908 AGATAAAGAAAGAGGAAGATGGG + Intergenic
1059125973 9:111685358-111685380 AATTAAAGAAAGGGGAAGGTAGG + Intergenic
1059648770 9:116294588-116294610 AGGTTTACAAAGGGGAAGCTTGG - Intronic
1059838779 9:118188892-118188914 ATATACACAAAAGGGAATGTTGG - Intergenic
1060002280 9:119969354-119969376 ACATAACCAAAGGGGATGCGGGG + Intergenic
1060033955 9:120239105-120239127 ATAAAGACAGAGGGGTAGCTGGG - Intergenic
1060127422 9:121061941-121061963 ATAGAAAGAAAGGGAAAGATAGG - Intergenic
1060318852 9:122536578-122536600 ATGTAAAGAAAAGGGAAGCCAGG - Intergenic
1060642132 9:125247939-125247961 ATATAAGTAAAAGTGAAGCTGGG + Intergenic
1061185181 9:129048862-129048884 AGATAAACAAGGCAGAAGCTTGG + Intronic
1185644146 X:1605161-1605183 GTACAAGCAGAGGGGAAGCTGGG - Intergenic
1185851038 X:3488983-3489005 TTAGAAACACAAGGGAAGCTTGG + Intergenic
1186444386 X:9614258-9614280 ATATACCCAAAGTGGGAGCTTGG - Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187235881 X:17466680-17466702 ATAATAACAAAGGAGATGCTAGG - Intronic
1187323092 X:18258966-18258988 ATAAAAACATGAGGGAAGCTGGG + Intronic
1187584017 X:20639806-20639828 ATATAAACCATGGTGAAGGTGGG - Intergenic
1188293169 X:28413606-28413628 ATTAAAACAAAGGAGAAACTTGG - Intergenic
1188486882 X:30691895-30691917 ATATGAACAAAGTGGAAGAGGGG - Intronic
1188681487 X:33013519-33013541 ATAAAAACAAACAGGAAGCCAGG + Intronic
1189453095 X:41157733-41157755 ATGCAAACAAATGGGAAGATGGG + Intronic
1189894125 X:45635882-45635904 ATATAAATAATGGGGAAGAAAGG - Intergenic
1190420800 X:50282429-50282451 AAACAAACAAAGGGGCAGCAGGG - Intronic
1190807966 X:53856979-53857001 ATATCAACAAAATGAAAGCTTGG - Intergenic
1192116922 X:68420271-68420293 ATAAAAACAATGGGGAACCGTGG + Intronic
1193177946 X:78416889-78416911 AGATAAACAAAGGGGAGACTAGG + Intergenic
1193262087 X:79419891-79419913 ATATAAACAAAGAAGAGTCTTGG + Intergenic
1195450988 X:105012738-105012760 ATTTCAACAAAGGGTAAGTTAGG + Intronic
1195589924 X:106612343-106612365 ATAGCAATAAAGGGGAGGCTTGG - Exonic
1196657744 X:118237459-118237481 ATATGAACAAAGGGCAGCCTCGG - Intergenic
1197432266 X:126380895-126380917 AAATAAATAAAGGGGAAGAAGGG + Intergenic
1198189815 X:134291467-134291489 AAAAAATCAAAGGGGAAGTTAGG - Intergenic
1198302080 X:135343195-135343217 CTATGAATAAAGGGGAGGCTGGG + Exonic
1199403891 X:147432877-147432899 AAATAAACAAATGGTAAGTTTGG - Intergenic
1199452405 X:147991334-147991356 ATATAAGCAAAGGTGAGGCAGGG - Intronic
1199833789 X:151568608-151568630 ATAAAAACAAAGAGAAATCTTGG - Intronic
1200419717 Y:2951800-2951822 ATATAAACAAAGAGGTAGGAGGG + Intronic
1201325586 Y:12754038-12754060 ATTTAAACATAGTGGAAGATGGG - Intronic
1201495202 Y:14585343-14585365 AAATAAATAAAGAGGAAACTTGG + Intronic
1202029523 Y:20557270-20557292 AGATAAATAAAGGGGAACCTGGG - Intergenic