ID: 1032632142

View in Genome Browser
Species Human (GRCh38)
Location 7:133664942-133664964
Sequence TTTTGTAAGTACATGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032632140_1032632142 19 Left 1032632140 7:133664900-133664922 CCAGGTCATTTTCATGGTATCTT 0: 1
1: 0
2: 0
3: 21
4: 283
Right 1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG 0: 1
1: 0
2: 0
3: 24
4: 361
1032632139_1032632142 20 Left 1032632139 7:133664899-133664921 CCCAGGTCATTTTCATGGTATCT 0: 1
1: 0
2: 4
3: 15
4: 228
Right 1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG 0: 1
1: 0
2: 0
3: 24
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032632142 Original CRISPR TTTTGTAAGTACATGCATTT TGG Intronic
901350568 1:8592205-8592227 TCTTGCATGTAAATGCATTTAGG - Intronic
901943277 1:12680313-12680335 TTTTGTATGTAAATGTCTTTAGG + Intergenic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
903443315 1:23404487-23404509 CTTTCTAAAAACATGCATTTTGG + Intronic
904843031 1:33386148-33386170 CTTTGTAAGGGTATGCATTTTGG + Intronic
905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG + Intronic
906919760 1:50050514-50050536 TGTGTTAAGTACATGCCTTTGGG + Intronic
908321467 1:62982906-62982928 TTTTATAATTACATTCTTTTTGG + Intergenic
908495051 1:64686474-64686496 TTTTGAAAGTAGAATCATTTTGG + Intronic
909001306 1:70220969-70220991 TTTTCAATGTACATGAATTTTGG - Intronic
909022538 1:70448047-70448069 TTTGCTAAGGACATGGATTTTGG - Intergenic
909936539 1:81557361-81557383 TTTTGTAAGAAAAAGCATTCTGG + Intronic
909940636 1:81607678-81607700 CTATGTAACTATATGCATTTTGG + Intronic
911333061 1:96547727-96547749 TTTTGTCAGTAGATGAATTTTGG - Intergenic
911663448 1:100528876-100528898 TTTTGTATTTTCAAGCATTTAGG - Intergenic
911790637 1:102011769-102011791 TTTTGCAAATCCATGAATTTAGG + Intergenic
912088103 1:106035384-106035406 TTCTGTAAGTTCATAGATTTTGG - Intergenic
912141348 1:106732421-106732443 TTTTGTAATTTCCTGCATGTAGG - Intergenic
912787805 1:112620845-112620867 TTCAGTAAGTACATGGTTTTAGG + Intronic
915233614 1:154464465-154464487 TTTTTTAAGTAAATGGATTTGGG + Intronic
917007755 1:170434207-170434229 TTTTGTAAGTACATGAAAGAGGG - Intergenic
917453076 1:175163310-175163332 TTATGTATCTTCATGCATTTGGG - Intronic
917730830 1:177872918-177872940 ATTTATAAGTATATGTATTTGGG - Intergenic
918700850 1:187605106-187605128 TTGAGTAACTACATGCAGTTAGG - Intergenic
919116435 1:193285853-193285875 ATTTGGAAGCACATGCATTTTGG + Intergenic
919228566 1:194741669-194741691 TTTTGTAAGTACCTTCCCTTTGG + Intergenic
922052740 1:222009562-222009584 TTTTGTAAGTCAATGCACTGGGG + Intergenic
922385668 1:225079602-225079624 TCTCGTAAGTCCAGGCATTTGGG + Intronic
922972198 1:229752097-229752119 TTTTGGAGGTAAATGCTTTTTGG + Intergenic
922974739 1:229774848-229774870 TTTTGCATTTACATGCATTTAGG + Intergenic
1063079367 10:2750994-2751016 TTTTGTATGTAAATGATTTTAGG - Intergenic
1063257249 10:4341925-4341947 TTATGTGTGTACATGCATGTGGG - Intergenic
1063275226 10:4558970-4558992 TTTTATATGTACATACATTTAGG + Intergenic
1065847675 10:29759615-29759637 TTCTGGAAGGACATGAATTTGGG + Intergenic
1066178972 10:32941226-32941248 ATTTCTAAGCATATGCATTTGGG + Intronic
1066537212 10:36404984-36405006 TTTTGGAAGTTCAACCATTTTGG + Intergenic
1068137067 10:52960713-52960735 TTTTGTATGCACTTGAATTTTGG - Intergenic
1068226224 10:54109956-54109978 TTTTGTGGGTACATATATTTTGG - Intronic
1068577629 10:58701959-58701981 TTTTGTATGAACATGAACTTAGG + Intronic
1068997053 10:63219342-63219364 TATTGTAAATACAAGCTTTTTGG - Intronic
1069825377 10:71252070-71252092 TTTTTAAAGCACAGGCATTTGGG - Intronic
1070521027 10:77253691-77253713 TGTTGAATGGACATGCATTTGGG + Intronic
1072028130 10:91485725-91485747 TTTTGTAAATAAAGTCATTTGGG - Intronic
1072241721 10:93501768-93501790 TTTTGTAACAACATACATTGAGG + Intronic
1072784696 10:98271767-98271789 TTTTGTAAGATCATGAAGTTGGG + Intergenic
1072788356 10:98300136-98300158 TTCTTTAACTATATGCATTTGGG + Intergenic
1072905786 10:99451987-99452009 TTTATTAAATACCTGCATTTAGG - Intergenic
1072988905 10:100170640-100170662 TTTTATTAATACATGGATTTTGG + Intronic
1073789306 10:106923381-106923403 TTTGGTAAGTGGATGGATTTTGG - Intronic
1073924505 10:108499510-108499532 TCAAGTAAGTACATGAATTTAGG - Intergenic
1073928871 10:108550582-108550604 ATTTGAAAGCAGATGCATTTTGG - Intergenic
1074011512 10:109486278-109486300 TTTACTAACTACATGAATTTGGG - Intergenic
1074234757 10:111574058-111574080 TTTAGTAAGTACATAAATTTGGG - Intergenic
1074357979 10:112802728-112802750 TTTTTTAAGTACAGGCCTATTGG + Intronic
1075677314 10:124304406-124304428 TTTTGGAAGGACATGGATGTCGG - Intergenic
1077110797 11:861183-861205 TTTTATAAGAACAAGCACTTAGG + Intronic
1078173856 11:8953707-8953729 TTTTCTCAGTACATGAATTAAGG - Intronic
1078549855 11:12272518-12272540 TATTGGAAATACAAGCATTTGGG + Intergenic
1078680815 11:13474021-13474043 TTTTGTATGTACATGAATGAAGG + Intergenic
1079441531 11:20519762-20519784 ATTTGTAAGATCATCCATTTGGG - Intergenic
1079547633 11:21653370-21653392 TTGAGTAAGTACATGAACTTTGG - Intergenic
1079647100 11:22878872-22878894 TTTTTTAAGGAAATGCATATGGG - Intergenic
1079843427 11:25432554-25432576 TTTACTAAGCACATGCATTCTGG - Intergenic
1080181964 11:29436247-29436269 TTTTTTAAGTTAATTCATTTAGG - Intergenic
1085990855 11:81842244-81842266 TTTTTTAAGTAAATTCATTGTGG + Intergenic
1086775220 11:90822565-90822587 TTTGGTAGACACATGCATTTAGG - Intergenic
1088519239 11:110677035-110677057 TTTTGTATTTATATGCCTTTGGG - Intronic
1089710700 11:120312421-120312443 TTTTATAATTCCATGCCTTTGGG - Intronic
1090261384 11:125323184-125323206 TTTTGTAAGTACAGGGATCCTGG + Intronic
1091849247 12:3681822-3681844 TTTGGCAGGTACATGCATTAAGG + Intronic
1092392137 12:8090087-8090109 TTTTATAAGTACCTTCAATTTGG + Intronic
1092695012 12:11161881-11161903 TTGTGTAAGGACAACCATTTTGG + Intronic
1093063724 12:14634045-14634067 TTTTTTAATTATATGTATTTGGG - Intronic
1093734976 12:22610620-22610642 ATTGGTAATTACATTCATTTGGG + Intergenic
1093740606 12:22681083-22681105 TTTTGGATGTACTTGTATTTTGG + Intronic
1093830758 12:23754561-23754583 ATTTGGAATTACATGTATTTAGG - Intronic
1093916651 12:24809806-24809828 ATTTGTTATTACCTGCATTTTGG + Intergenic
1095042833 12:37462717-37462739 TTTTGCATGTACATTCATTAGGG + Intergenic
1095142539 12:38683844-38683866 TTTTGTAAGTTCTTGAATATAGG - Intronic
1095585153 12:43841643-43841665 TTTTTTAAATACACGCATTTTGG - Intronic
1098580398 12:72092730-72092752 CATTCTTAGTACATGCATTTTGG - Intronic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1099169372 12:79345237-79345259 TTTACAAAGAACATGCATTTGGG + Intronic
1099419059 12:82430021-82430043 CTTTGTAAGAAAATGCAATTGGG - Intronic
1099909671 12:88814334-88814356 AGTTGTCAGTGCATGCATTTTGG - Intergenic
1099939531 12:89169156-89169178 TTTTGAAAGTTCATGATTTTGGG - Intergenic
1100164789 12:91904188-91904210 TTTAGTAAGAACATGGATTCAGG + Intergenic
1100683702 12:96960966-96960988 TCTTGTCAGTACTTGGATTTGGG - Intergenic
1103785023 12:123426107-123426129 TTTTGTAATTACAAAAATTTAGG - Intronic
1103808715 12:123595518-123595540 TGTTGTAAATAATTGCATTTTGG + Intronic
1106374059 13:29166873-29166895 TTTTTAAAGTAAATGTATTTCGG + Intronic
1106529455 13:30576113-30576135 TTTTATTTGTATATGCATTTGGG - Intronic
1108390133 13:49938857-49938879 TTTTGTCTATACATGCATTATGG - Intergenic
1108566677 13:51706377-51706399 TTGTGTATGAACATGCACTTGGG + Intronic
1109114376 13:58362340-58362362 TTTTGTGAGTACTGGAATTTGGG - Intergenic
1109416685 13:62049911-62049933 TTTTATAAATAAATGTATTTGGG - Intergenic
1109494807 13:63155849-63155871 ATTTGTAAGTAGATACATGTTGG + Intergenic
1109836384 13:67862921-67862943 TTTTCTAAGTAAATTCACTTAGG - Intergenic
1109962745 13:69653613-69653635 TTTTGTAATTAAATTCTTTTAGG + Intergenic
1110453822 13:75667906-75667928 TTTTGTTAAAACAGGCATTTAGG + Intronic
1111515738 13:89328427-89328449 TTTTGTAAATTCCTGCATTCCGG + Intergenic
1112085709 13:96029847-96029869 TGTTCTCAGTACATGCTTTTTGG - Intronic
1112659857 13:101495623-101495645 TTTTTTAAGTAAATGATTTTTGG + Intronic
1113027236 13:105954581-105954603 TTTTGTAAATATGTGCTTTTGGG + Intergenic
1115097729 14:29658293-29658315 TGTGGGAAGTACATGCACTTTGG - Intronic
1115159878 14:30381843-30381865 TTATAAAAATACATGCATTTGGG + Intergenic
1115260993 14:31453782-31453804 ATTTGTAAGTAAATGGATTAGGG - Intronic
1115742141 14:36399592-36399614 CTTTGGATGTACCTGCATTTAGG - Intergenic
1116172228 14:41417567-41417589 TTTTGTGTATTCATGCATTTGGG + Intergenic
1118093781 14:62513434-62513456 TTGTTTAAGGACATGCATATGGG - Intergenic
1118458367 14:65965571-65965593 ATTTATAAGTACATGCTTCTTGG - Intronic
1119677066 14:76563682-76563704 TTTGGGAAGTACTTGCATTTGGG + Intergenic
1120652919 14:87155957-87155979 TTTTGAAAGGATATGCATTTTGG + Intergenic
1120670972 14:87362234-87362256 TTTTGGAAATAGTTGCATTTGGG + Intergenic
1122130083 14:99599917-99599939 TTGTGTATGTACATGCAAATAGG - Intronic
1123102599 14:105815603-105815625 CTTGGGAAGTACATGCACTTTGG - Intergenic
1123825764 15:24080688-24080710 TTTTGTCTGCAAATGCATTTAGG + Intergenic
1124699338 15:31898665-31898687 TATTGTAGTTACATGAATTTGGG - Intergenic
1124713895 15:32040159-32040181 TTTTGTAGGCACATACAGTTGGG + Intronic
1126391920 15:48166709-48166731 TTTTGTCATTACATTCATATGGG - Intronic
1127357154 15:58211277-58211299 TTTTTTAAGCAACTGCATTTGGG + Intronic
1127428477 15:58879096-58879118 TTTTGTAAATACTTGTATGTGGG - Exonic
1127476928 15:59343462-59343484 TTTTGTTATTACATGCCTTGAGG + Intronic
1127938038 15:63662530-63662552 TCTTGTAAATACCTCCATTTAGG - Intronic
1128180910 15:65603104-65603126 TTTGGTAAATCCATGCATATAGG - Intronic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1129840678 15:78741635-78741657 CTTTTTAAGTACATTTATTTAGG - Intergenic
1131353474 15:91722867-91722889 TTTTGGGAGTGCATGTATTTGGG - Intergenic
1131416426 15:92263457-92263479 TATTCAAATTACATGCATTTAGG + Intergenic
1131784399 15:95896277-95896299 CTTTGAAACTAAATGCATTTAGG - Intergenic
1137234347 16:46601843-46601865 TTTTGAAAATCCATTCATTTAGG - Intronic
1137923241 16:52512996-52513018 TTATGTACTTACATGTATTTTGG - Intronic
1142606853 17:1086809-1086831 TTTTTAAAGTACATGCAGCTGGG + Intronic
1142792586 17:2279475-2279497 ATTTGGAAGTTCATTCATTTGGG + Intronic
1145078224 17:19872971-19872993 TTTTGGGATTACAGGCATTTTGG + Intergenic
1146748395 17:35352834-35352856 TTTTGTAAGTACTTGGCTATTGG + Exonic
1147964221 17:44185224-44185246 TTTTGTAAGTCCTTTCATTGTGG - Intergenic
1148949463 17:51297631-51297653 TTTTAAAGGTACAGGCATTTTGG + Intronic
1150898113 17:69237655-69237677 TTTAGGAAGGACATGAATTTTGG - Intronic
1151348417 17:73517272-73517294 TTTGGGAAGGACATGAATTTGGG - Intronic
1151789676 17:76296882-76296904 TTTGATGAGTACATGCATGTGGG + Intronic
1152428720 17:80235218-80235240 TTTTTTAAGTATATGGAATTTGG + Intronic
1153149715 18:2077921-2077943 CATTGTAAGTACAGTCATTTTGG + Intergenic
1153566521 18:6424017-6424039 TTTTATAAGAATTTGCATTTTGG - Intergenic
1154471942 18:14712147-14712169 TTATGTATGTAAATGTATTTTGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155690535 18:28616574-28616596 TTGTAAATGTACATGCATTTTGG - Intergenic
1156609968 18:38714326-38714348 TTTGGTAATTCTATGCATTTTGG + Intergenic
1156933653 18:42676208-42676230 TTTTGAAAGAACGTGGATTTTGG - Intergenic
1157720805 18:49922760-49922782 TTTTGTAATTACAGGTATTGTGG - Intronic
1157909670 18:51604033-51604055 TTTTGTAAATTCATAAATTTAGG + Intergenic
1157915535 18:51660400-51660422 GTTTATAAGTACATGCAACTCGG - Intergenic
1158410121 18:57198240-57198262 TTTTAAAAGCACATGTATTTTGG + Intergenic
1158659712 18:59375167-59375189 TTATGTAAGTAAATACATTTAGG + Intergenic
1158681744 18:59573945-59573967 TTTTGACAGTTCATTCATTTAGG - Intronic
1159131726 18:64287504-64287526 TTTTAAAAGTACATACATTCTGG - Intergenic
1159266816 18:66091283-66091305 ATTTGTAATCATATGCATTTAGG - Intergenic
1164048193 19:21561028-21561050 TTTTTTAAGTTCATGGATTCTGG - Intergenic
1166330817 19:42077005-42077027 TTTTTTAAGTACAGGTAATTAGG + Intronic
927070098 2:19519362-19519384 TTTTGTAAATTGATGCAATTTGG + Intergenic
927379712 2:22464832-22464854 ATTTGTAAGTACTGGCATTTTGG + Intergenic
927749958 2:25659074-25659096 TTTTTTAATTGCATGCATTAAGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929068403 2:38004021-38004043 TTTGCTAAGTACATGTAATTGGG - Exonic
929170190 2:38924643-38924665 TTTTCTAAATCCATGAATTTAGG + Intronic
929985058 2:46721688-46721710 ATTTGTAACTACATATATTTTGG - Intronic
930390685 2:50758348-50758370 TTTTGTTAGCATCTGCATTTGGG - Intronic
930636453 2:53811314-53811336 TTTTGTAAGTATATTCATAAGGG + Intronic
931087814 2:58852915-58852937 TTTTTTAATTTCATGTATTTAGG - Intergenic
933425547 2:82107484-82107506 TTCTGTTACTACATACATTTAGG + Intergenic
937492123 2:122380742-122380764 TGTTTTAAGTAGCTGCATTTTGG + Intergenic
937725126 2:125155029-125155051 TTTGGTAATTACATGTTTTTAGG + Intergenic
939067495 2:137501670-137501692 TTTTATAAGTACAATCATATTGG - Intronic
939223143 2:139329271-139329293 TTTTGTAAGGGCAAGCAATTTGG + Intergenic
939392960 2:141592343-141592365 TCTGGTAAGGACCTGCATTTTGG + Intronic
939495981 2:142929093-142929115 TTATGTATGTACATTAATTTTGG - Intronic
940293073 2:152097087-152097109 TTATGGAAATAAATGCATTTTGG - Intronic
940608565 2:155960770-155960792 TTTTCGAAGTACAGGCATTATGG - Intergenic
941101815 2:161305096-161305118 CTTTGTATATACATACATTTTGG + Intergenic
941412898 2:165182292-165182314 ATTTCTAAGTCCATGCCTTTTGG - Intronic
941483133 2:166043461-166043483 TTTAATAAGTAAATGCATTCAGG + Intronic
941590729 2:167417071-167417093 TGTTAGAAGGACATGCATTTTGG + Intergenic
942397452 2:175566827-175566849 ATGTGTGAATACATGCATTTTGG + Intergenic
942889398 2:180969394-180969416 TTTCATAAGTTCATGCATTGGGG - Intronic
943545931 2:189277840-189277862 CTTTGGCAGTATATGCATTTGGG + Intergenic
944074248 2:195709695-195709717 TTTTGTTACTACATTTATTTTGG + Intronic
944193870 2:197031701-197031723 ATTTGAAATTACATGCTTTTAGG - Intronic
944287813 2:197971963-197971985 TACTGCCAGTACATGCATTTTGG + Intronic
944327328 2:198421824-198421846 TACTGGGAGTACATGCATTTTGG + Intronic
944453189 2:199865030-199865052 TTTTGTAAGTAGATAGATTTGGG + Intergenic
944765484 2:202860437-202860459 CTTTTAAATTACATGCATTTGGG - Intronic
944972762 2:205012908-205012930 TTTTGGAAGTGCTTTCATTTGGG - Intronic
946524697 2:220505873-220505895 CTTTGTAACCACATGAATTTGGG + Intergenic
947071769 2:226295761-226295783 TTTTTTAAGTCCCTGTATTTGGG + Intergenic
947462100 2:230312577-230312599 TTTTTTCAGTACAAGGATTTTGG + Exonic
948498289 2:238369751-238369773 CTTTGTAATTACTAGCATTTTGG + Intronic
1169832008 20:9835895-9835917 TTTTGTTATTTAATGCATTTTGG + Intronic
1170502060 20:16984268-16984290 TGATGTGAGTACATGCTTTTGGG - Intergenic
1170868870 20:20186315-20186337 TTTTTAAAGTTCATGCATGTTGG + Intronic
1172540285 20:35709027-35709049 TTTTTTAAGTCCATTAATTTGGG + Intronic
1173044107 20:39492978-39493000 TTTTGTAAGAACATGCCTCCTGG - Intergenic
1173129245 20:40372451-40372473 TTTGGAAAATACAGGCATTTAGG + Intergenic
1173975147 20:47181195-47181217 TTTTGCAAGCCCTTGCATTTGGG - Intronic
1174975729 20:55331465-55331487 TTTTGTAAGAACATGAGTTGAGG - Intergenic
1175438813 20:58976019-58976041 TGTTGTAAGTAAATCAATTTGGG - Intergenic
1175560597 20:59925783-59925805 TATAGTACCTACATGCATTTGGG - Intronic
1176802552 21:13445742-13445764 TTATGTATGTAAATGTATTTTGG - Intergenic
1177947638 21:27491952-27491974 TTTTGTCTGTAAATGGATTTGGG - Intergenic
1178364308 21:31975856-31975878 TTTTGTTAGCAAATGGATTTGGG + Intronic
1180577677 22:16794951-16794973 TTTTGTATGTATGTGTATTTAGG - Intronic
1181741997 22:24928655-24928677 TTTTCTAAATACATGCACTCGGG + Intergenic
1182408183 22:30156420-30156442 TTTTGTTTCTACATTCATTTAGG - Intronic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
951026084 3:17831820-17831842 ATAGTTAAGTACATGCATTTGGG - Intronic
951460131 3:22942445-22942467 TTTTGTGAGTGAAGGCATTTGGG - Intergenic
951864222 3:27289269-27289291 CTTTCTAAGCACCTGCATTTGGG + Intronic
952412419 3:33061548-33061570 TTTTGTAAGTAAAAGTATATTGG - Intronic
954528298 3:51293999-51294021 TATTGTAAATACAGCCATTTTGG + Intronic
954546685 3:51442345-51442367 TTTTTTAAGTACATACTTTTTGG + Intronic
956121341 3:65969307-65969329 GTTTGGAAGTACTGGCATTTTGG + Intronic
957182339 3:76895814-76895836 TTTTTTAAGTAATTTCATTTTGG + Intronic
957275628 3:78087732-78087754 TTATGTAAGAACATGAATTCTGG - Intergenic
957883030 3:86247250-86247272 TGTTTTAAGTCCATTCATTTTGG + Intergenic
958004505 3:87793746-87793768 TTTCGTAAGGACAGGCACTTTGG + Intergenic
958437919 3:94120939-94120961 AGTTGTAACTACATTCATTTTGG - Intronic
959393222 3:105802596-105802618 TTTTATAGGTAGATGCTTTTAGG - Intronic
959429391 3:106234213-106234235 CTTTTTAATTACATACATTTTGG + Intergenic
959794870 3:110414121-110414143 TCTTTAAAGTACATGCATATTGG - Intergenic
960171342 3:114465059-114465081 TTTTTTAAGTACAAGAATTTAGG - Intronic
960989688 3:123302333-123302355 TTTTGTGCCTACAGGCATTTGGG - Intronic
961174756 3:124825388-124825410 TTTTATAAATACTTGCATATAGG - Intronic
962083220 3:132162845-132162867 TTGTGTAAATACATGCATGATGG - Intronic
963189138 3:142449969-142449991 TTATGTTAGTACATGCAAATGGG + Intronic
963671955 3:148261981-148262003 ATAAGTAAGTACATGAATTTGGG + Intergenic
963863358 3:150333528-150333550 GTTTGTAAATAGATTCATTTTGG - Intergenic
963933622 3:151029715-151029737 TTTTTTAAGTACCTGCTTTAAGG - Intergenic
964001715 3:151782647-151782669 TATTGAAGCTACATGCATTTGGG - Intergenic
964817629 3:160733521-160733543 TTTTCTAATAACATGCACTTAGG - Intergenic
965225117 3:165979153-165979175 TTTTCTTAGCACTTGCATTTTGG + Intergenic
965260838 3:166482882-166482904 TTATGGCAGTACATGCATTTTGG - Intergenic
966070741 3:175874360-175874382 TTTTTTTAGTACATACTTTTTGG - Intergenic
968009164 3:195261688-195261710 TTTTTTAAGAAAATGCATTTCGG + Intronic
968262902 3:197339571-197339593 GTTTGAAAGTACCTACATTTTGG + Intergenic
969178195 4:5416113-5416135 TTTGGTCAGTACTTGCTTTTTGG - Intronic
969921553 4:10545117-10545139 GTATGTGAGGACATGCATTTCGG - Intronic
971092071 4:23357225-23357247 TTTTGTAAGTAAATATATTTTGG + Intergenic
971412292 4:26386721-26386743 ATTTGAAAGTAAATGCTTTTAGG + Intronic
972729924 4:41784362-41784384 TTTTGTTAGCACAGCCATTTTGG + Intergenic
973113635 4:46427483-46427505 AATTGTAAGAAGATGCATTTTGG - Intronic
973837285 4:54822648-54822670 TTATTTAATAACATGCATTTGGG + Intergenic
974543909 4:63275488-63275510 CTTTGACAGTACATGCATGTGGG + Intergenic
975452555 4:74546306-74546328 TTTTGTAAGAATAGGCATTAGGG - Intergenic
976969442 4:91087116-91087138 TTCTATAAGTAGATCCATTTTGG - Intronic
977139932 4:93356845-93356867 ATTTTTATGTACAAGCATTTTGG + Intronic
977169733 4:93746602-93746624 TTTTGTACTTTCTTGCATTTTGG - Intronic
977295259 4:95202586-95202608 TTTTTTAAGTGCATCCTTTTGGG + Intronic
977806921 4:101310859-101310881 CATTTTAAGTACATTCATTTAGG - Intronic
978231790 4:106408591-106408613 CTTTAGAAGTTCATGCATTTGGG - Intergenic
978461514 4:108959165-108959187 TTTAGGTAGGACATGCATTTTGG - Intronic
979555158 4:122037900-122037922 TTGTGTAAGTTCACTCATTTTGG - Intergenic
981516708 4:145618340-145618362 TTGTGTAATGATATGCATTTGGG - Exonic
983809861 4:172048286-172048308 TTTTTTAAGTTCATGGAGTTTGG - Intronic
984375047 4:178919847-178919869 TTTTGTAGGTATATGCAATGAGG - Intergenic
986417030 5:7539339-7539361 TTTTTTAATCCCATGCATTTTGG - Intronic
986816091 5:11413599-11413621 TTTCTTAAGTATATGTATTTTGG + Intronic
986896455 5:12376477-12376499 TTTTTTAAGTACAGTAATTTAGG + Intergenic
988763718 5:34346470-34346492 TTTGGTCAGTACCTGCAGTTAGG - Intergenic
989544298 5:42654791-42654813 TTTTGCAAGCACTGGCATTTAGG + Intronic
989622294 5:43396662-43396684 TGTTTTAAATAAATGCATTTAGG - Intronic
990738081 5:58886066-58886088 GTTTGAAAGTACACTCATTTGGG - Intergenic
990746455 5:58963955-58963977 TTTGGGAAGTACATGCCTTTGGG + Intergenic
990779405 5:59342552-59342574 TTTTTAAAGTACATAAATTTTGG + Intronic
991023988 5:62010044-62010066 CTTTGTAAGTACCTGCCTTTTGG + Intergenic
991331060 5:65492379-65492401 TATTGAAAGTATATGCAATTTGG - Intergenic
991965892 5:72090450-72090472 TTTTGTAATGTCATGCTTTTTGG - Intergenic
992832322 5:80606125-80606147 TTTTCTAAGTTTAGGCATTTTGG + Intergenic
993068190 5:83127168-83127190 TGTTATAAGGACATGAATTTGGG + Intronic
994595212 5:101823905-101823927 TATAGAAAGTACATTCATTTAGG - Intergenic
994687675 5:102975993-102976015 TTTGCCAAGTACATGCACTTGGG - Intronic
995256678 5:110054714-110054736 TTTTGTAAAGTCATGCACTTCGG + Intergenic
995619577 5:114009349-114009371 TTTTTTAAGTTCAAGGATTTTGG + Intergenic
995785259 5:115820871-115820893 TTTGGTAAGCACATTCAATTTGG - Intergenic
996596452 5:125208784-125208806 TTTTGTACTTACACCCATTTTGG - Intergenic
996622582 5:125526309-125526331 TGATATAAGTGCATGCATTTTGG + Intergenic
997011817 5:129887489-129887511 TTTTGTAAGGTCATGAAATTTGG + Intergenic
998328388 5:141302623-141302645 ATTTGTGTGTACATGCAGTTTGG - Exonic
998744224 5:145238484-145238506 ATGTGTAAATAAATGCATTTAGG - Intergenic
998882413 5:146656973-146656995 TTTTGTTAGTAAATGCGTTCTGG - Intronic
998933811 5:147212615-147212637 CTTTGAAAGTACCTGCTTTTTGG - Intergenic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1001807299 5:174598320-174598342 TTATGTATATACATACATTTTGG + Intergenic
1003055473 6:2814605-2814627 TTTTTTAAGCTCTTGCATTTGGG + Intergenic
1003209868 6:4052712-4052734 TCTCGTAAGTTCATGCTTTTAGG - Exonic
1004234085 6:13858537-13858559 TTTGGGAATTACATTCATTTGGG - Intergenic
1004850022 6:19689836-19689858 CTTTGTTAGAACAGGCATTTCGG + Intergenic
1006355289 6:33552834-33552856 TTTTGTAAGAATACACATTTTGG - Intergenic
1008136000 6:47777714-47777736 ATTTGTAAGTCCATTCAATTTGG + Intergenic
1008426767 6:51367473-51367495 TCTTGCAGGTACATGCATTGAGG + Intergenic
1008698759 6:54073490-54073512 TGATGAAAGTACATGCGTTTAGG - Intronic
1008802461 6:55386480-55386502 TTTTGTAAGTATATGTGTATAGG + Intronic
1009200526 6:60739361-60739383 TTTAGAAATTACATGGATTTGGG + Intergenic
1009701102 6:67182507-67182529 TTTTAAAAGTAAATTCATTTTGG - Intergenic
1009853888 6:69234351-69234373 TTTTTCAAGGTCATGCATTTAGG + Intronic
1012935245 6:105360788-105360810 TTTTGTAAAAACATTTATTTGGG - Intronic
1013426731 6:110019051-110019073 GTTTGTAATCAAATGCATTTGGG - Intergenic
1013826943 6:114224048-114224070 TTGTGTTAGTAAATGCTTTTGGG + Intronic
1014929453 6:127317274-127317296 TTTTGAAACTGCATGGATTTAGG - Intronic
1014964688 6:127732718-127732740 TAGAGTAAGTAAATGCATTTTGG - Intronic
1015054084 6:128878215-128878237 TTTTGAATGTACATGTCTTTTGG - Intergenic
1015294577 6:131575963-131575985 TTATGTGAGTACATGCACGTAGG + Intronic
1015516686 6:134089440-134089462 TTTTTTAAAAACATGAATTTGGG + Intergenic
1016616414 6:146053690-146053712 GTTTCTAATTGCATGCATTTGGG - Intronic
1017240487 6:152163120-152163142 TATTGTTACTCCATGCATTTAGG - Intronic
1018348446 6:162928126-162928148 ATTTGTCAGTAAATCCATTTGGG + Intronic
1018653611 6:166011276-166011298 TTTTGTAAGGAGTTTCATTTGGG + Intergenic
1019729317 7:2621859-2621881 TTTGGTGAGTAAATGAATTTAGG - Intergenic
1020370695 7:7429120-7429142 TTTTGTAAGTTAATGCCTTAAGG + Intronic
1021317836 7:19171820-19171842 TTTGGCATGTACATGGATTTTGG + Intergenic
1021332956 7:19361625-19361647 TTTTATAAGTACAAGCATTGTGG + Intergenic
1022801304 7:33779934-33779956 TTTTGTATGGAAATGTATTTAGG + Intergenic
1022868883 7:34454802-34454824 TTTTTATAGTAAATGCATTTAGG + Intergenic
1023421998 7:39990429-39990451 TGTAGTTAGTACATACATTTAGG - Intronic
1023516383 7:41005860-41005882 TTGTGTAAGTACTCCCATTTTGG + Intergenic
1023746209 7:43325314-43325336 ATTTTTTAATACATGCATTTGGG + Intronic
1025226119 7:57165097-57165119 TATTGTAAGTAAATTCATTCTGG - Intergenic
1028127546 7:87131061-87131083 TATTGTGAGCACATGCATTCTGG + Intergenic
1028747469 7:94343989-94344011 TTTTTTAATTACAAGAATTTGGG + Intergenic
1030087844 7:105832235-105832257 TTTTCAAAGTATTTGCATTTGGG + Intronic
1030165059 7:106545912-106545934 TTTTGGATTTACATGTATTTAGG + Intergenic
1031415442 7:121490603-121490625 TATTATAAGAACGTGCATTTTGG - Intergenic
1031515934 7:122698651-122698673 TATTGGGATTACATGCATTTTGG + Exonic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1032968144 7:137126158-137126180 TTTTTTTAGTGCATGCATTAGGG - Intergenic
1033894845 7:146057019-146057041 TTTCCTAAGGACTTGCATTTGGG + Intergenic
1033958903 7:146888017-146888039 TTTTCTAAGTAAATAAATTTTGG - Intronic
1035409130 7:158624456-158624478 TTTTGTAAAGACAGGGATTTGGG - Intergenic
1035796439 8:2361730-2361752 TTTTGTAAGTGCCTGCATGGTGG + Intergenic
1039728639 8:40250895-40250917 TTTTGAGAGTAAATTCATTTTGG - Intergenic
1041211966 8:55560397-55560419 TTTTTTAAGTACATACATATAGG + Intergenic
1041588970 8:59554272-59554294 TTGAATAAGTAAATGCATTTGGG + Intergenic
1044005811 8:86935840-86935862 TTTTTAAAAAACATGCATTTGGG + Intronic
1044048759 8:87472927-87472949 TTTTTAAATTACATGCAGTTTGG + Intronic
1044736469 8:95284105-95284127 TGTTGCATGTACATGCAGTTTGG - Intergenic
1045123895 8:99068446-99068468 TTTTGTAAATACAAGTTTTTTGG + Intronic
1046256439 8:111702987-111703009 TATTTTAAGTTTATGCATTTTGG - Intergenic
1047548675 8:125845676-125845698 TTTTGTATGTATATGTTTTTTGG + Intergenic
1050007322 9:1146382-1146404 GTTTTAAAGTACTTGCATTTCGG + Intergenic
1050485487 9:6129977-6129999 TTGTTTAAGTACATTTATTTAGG - Intergenic
1050910549 9:11064029-11064051 TTTTGTAAGTCAATTTATTTAGG + Intergenic
1050994687 9:12201268-12201290 ATTTTTAAGTAAATGCATTTGGG - Intergenic
1051462116 9:17331967-17331989 TTTTGTAAGGCCATGCAGTAAGG + Intronic
1052324603 9:27204047-27204069 TTTTGTAATTACTTGTGTTTTGG + Intronic
1052354753 9:27493109-27493131 GTATGTAAGAACATACATTTGGG + Intronic
1052732804 9:32309519-32309541 TTTTGTGAGTCCATGAACTTTGG - Intergenic
1052846756 9:33343332-33343354 TTTTGTGATTACATGCAATGAGG - Intronic
1053531400 9:38885436-38885458 TTTTGTAGAAAAATGCATTTAGG - Intergenic
1054203624 9:62109865-62109887 TTTTGTAGAAAAATGCATTTAGG - Intergenic
1054634738 9:67478499-67478521 TTTTGTAGAAAAATGCATTTAGG + Intergenic
1054704377 9:68447923-68447945 TTGTTTAAATACAGGCATTTGGG + Intronic
1055183242 9:73416526-73416548 TTTTGTCATTTCATTCATTTTGG - Intergenic
1056750587 9:89348028-89348050 TCTTTTAAGTACAAGTATTTAGG + Intronic
1057338324 9:94175681-94175703 TCTTGTAAATACATGGTTTTAGG + Intergenic
1058783192 9:108360020-108360042 TCCTGTAATAACATGCATTTAGG - Intergenic
1058842849 9:108926725-108926747 TTTTTTAAGTCAAAGCATTTTGG - Intronic
1059196801 9:112378319-112378341 TAGTGTAAGTACAGGTATTTAGG + Intergenic
1059565209 9:115377648-115377670 TTTTGTAACTATATCCTTTTGGG - Intronic
1059642149 9:116227864-116227886 GTTTGTAACTACAAGCAGTTGGG - Intronic
1059858111 9:118424265-118424287 TTCTGTAAGTACATCCATAGAGG - Intergenic
1059988940 9:119846544-119846566 TTATGTAAGCCCCTGCATTTTGG - Intergenic
1187057006 X:15750128-15750150 TTTTGTAAGTACAAGTATAGAGG - Exonic
1187362527 X:18641749-18641771 TTTTGTAAGAAAATTCGTTTCGG + Exonic
1188067871 X:25683544-25683566 AATTGTAATTACATGCATCTGGG - Intergenic
1188616346 X:32163398-32163420 TTTTCTAAGTAAACTCATTTGGG - Intronic
1190423244 X:50307430-50307452 TATGGTAAGAACATGCATTCTGG - Intronic
1191021146 X:55861566-55861588 TATTGTAACTACTTGCAATTAGG - Intergenic
1191901779 X:66048086-66048108 TTTTTGTATTACATGCATTTGGG - Intergenic
1193598626 X:83480402-83480424 TTTTGTATGTATATACATTAGGG - Intergenic
1193964902 X:87973261-87973283 TTTCGTTTGTATATGCATTTAGG + Intergenic
1194396348 X:93392026-93392048 TTTTGTTATTACATGCCTTGAGG + Intergenic
1194555817 X:95357382-95357404 TTTACTAAGTTCTTGCATTTTGG - Intergenic
1196361122 X:114860649-114860671 TTTTGTAAAAAGATTCATTTAGG + Intronic
1196501830 X:116392959-116392981 ATTTTCAAATACATGCATTTAGG + Intergenic
1196997805 X:121402908-121402930 TTATGTGAGCACATGAATTTTGG + Intergenic
1197128613 X:122977337-122977359 TTTTTTAAATACAGGAATTTGGG + Intergenic
1197517593 X:127454252-127454274 ATTTATAAGAACATGGATTTGGG + Intergenic
1201461600 Y:14231662-14231684 TCTTGTATGTAAATGAATTTAGG - Intergenic