ID: 1032632521

View in Genome Browser
Species Human (GRCh38)
Location 7:133669256-133669278
Sequence AGCCGCGGGATGTAAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032632512_1032632521 28 Left 1032632512 7:133669205-133669227 CCAAATCGAGCTGTCTCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1032632521 7:133669256-133669278 AGCCGCGGGATGTAAGGAAAAGG 0: 1
1: 0
2: 0
3: 1
4: 68
1032632517_1032632521 -1 Left 1032632517 7:133669234-133669256 CCTTTACAGTGGTGAGAGGAGGA 0: 1
1: 0
2: 0
3: 20
4: 183
Right 1032632521 7:133669256-133669278 AGCCGCGGGATGTAAGGAAAAGG 0: 1
1: 0
2: 0
3: 1
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032632521 Original CRISPR AGCCGCGGGATGTAAGGAAA AGG Intronic
901292409 1:8134421-8134443 AGTCGGGGGAGCTAAGGAAATGG - Intergenic
903027607 1:20440847-20440869 AGCAGCGGGAAGTGAGGAAGAGG + Intergenic
911317579 1:96374039-96374061 ACCCTTGGGATGTAAGCAAATGG - Intergenic
915845460 1:159259412-159259434 AGCCGCAGGAAGTAAGGTGAAGG - Intergenic
923188846 1:231600120-231600142 AGGTGCCGGATGGAAGGAAAGGG - Intronic
923849188 1:237774677-237774699 AGCCAGGAGAGGTAAGGAAATGG - Intronic
1074866843 10:117549161-117549183 AGCCTCAGGATGTTAGGAAAGGG - Exonic
1076940649 10:133604922-133604944 CTCCCCAGGATGTAAGGAAATGG - Intergenic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084390225 11:68870622-68870644 AGCCGAAGGACGTAAGGAACAGG + Intergenic
1088179105 11:107088951-107088973 AGCCACGAGATGGAAGGAACAGG + Intergenic
1091743802 12:2978017-2978039 TCCCGAGGGATGGAAGGAAAGGG - Intronic
1098406015 12:70126674-70126696 AGAGGCAGGCTGTAAGGAAAGGG - Intergenic
1101030326 12:100651887-100651909 AGCCGCTGGAGGAGAGGAAAAGG - Intergenic
1105081268 13:16121946-16121968 AGCTGCTGAATGAAAGGAAATGG - Intergenic
1105201969 13:18188806-18188828 ATCCATGGGATGAAAGGAAAGGG - Intergenic
1107869962 13:44737239-44737261 AGCTGGGGGATGCAAGGAAGGGG - Intergenic
1110770884 13:79344287-79344309 TTCAGCAGGATGTAAGGAAAAGG - Exonic
1112209264 13:97358831-97358853 AGCTATGGGATTTAAGGAAATGG - Intronic
1116835838 14:49768365-49768387 AGCGGCGCGAGGCAAGGAAAAGG - Exonic
1122774942 14:104112968-104112990 AGGCGCAGGAGGTAAGGAGATGG - Exonic
1122910937 14:104827266-104827288 GTCCGCGGGAAGGAAGGAAAAGG + Intergenic
1128542026 15:68542956-68542978 AGCTGCCGGATGTATTGAAAAGG + Intergenic
1132587408 16:711618-711640 GGCCGGGGGCTGTGAGGAAAAGG + Intronic
1134809363 16:17154218-17154240 AGCCATGGGATGTCAGCAAATGG - Intronic
1141903283 16:87006638-87006660 AGCCGGGGGAGATGAGGAAAGGG + Intergenic
1142810530 17:2393696-2393718 AGCCGCGGGAGGGAAGGGCATGG - Intronic
1146928823 17:36763733-36763755 CGTGGCGGGATGTGAGGAAAGGG - Intergenic
1147745452 17:42691821-42691843 AGCCCCGGTGTGGAAGGAAATGG - Exonic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1166318536 19:42002568-42002590 AGCCGCTGGATGTGAGGAGGGGG + Intronic
1166409510 19:42547219-42547241 ACCCTAGGGATGAAAGGAAAGGG + Intronic
925001561 2:406987-407009 AGCCGCAGGTTGTCAGGAAGGGG - Intergenic
930173927 2:48281890-48281912 AGCCTCGGGAAGTCAGGGAAAGG - Intergenic
940286991 2:152042304-152042326 AGCAGACGGATGAAAGGAAATGG - Intronic
942046297 2:172101261-172101283 CGCCGTGGGAGGGAAGGAAAGGG - Intronic
943381794 2:187158708-187158730 AGCTGTGGGAACTAAGGAAATGG - Intergenic
947906752 2:233769929-233769951 AGCCGCTGGAAGGAAGGAATGGG - Intronic
948945492 2:241217194-241217216 AGCCGCGGCATCTGTGGAAAGGG + Intronic
1176715983 21:10349199-10349221 ATCCATGGGATGAAAGGAAAAGG + Intergenic
1178047148 21:28708466-28708488 ATCCCAGGGATGAAAGGAAATGG + Intergenic
1181067059 22:20311757-20311779 AGCCCAGGGATGGAGGGAAAGGG + Intergenic
955988421 3:64599494-64599516 GGCTGCCAGATGTAAGGAAAAGG - Intronic
962505117 3:136039010-136039032 AGCCAAGGGAGGTAAGGACAGGG - Intronic
967990265 3:195125351-195125373 AGCCCCGCAATGGAAGGAAATGG - Intronic
968962929 4:3754506-3754528 GGCAGAGGGAAGTAAGGAAAGGG + Intergenic
969323328 4:6426161-6426183 AGCCTTGGGGTGTCAGGAAAAGG + Intronic
975953920 4:79812670-79812692 ATCTGAGGGATGTAAGGGAAGGG - Intergenic
979579650 4:122342205-122342227 AGCAGTGAGATGGAAGGAAATGG + Intronic
982266629 4:153544042-153544064 AGCCGCTGGATGTTGGCAAAAGG - Intronic
987376670 5:17241828-17241850 AGCTGCAGGATTTAAGGACAAGG + Intronic
991733431 5:69610503-69610525 AGCAGTGTGATGTAAAGAAAAGG + Intergenic
991809866 5:70465649-70465671 AGCAGTGTGATGTAAAGAAAAGG + Intergenic
991861522 5:71017347-71017369 AGCAGTGTGATGTAAAGAAAAGG - Intronic
992753493 5:79882740-79882762 AGACGTGGGAGGTAAGGAGAAGG - Intergenic
998736006 5:145142437-145142459 AGCCACTGTATGTAAAGAAAAGG - Intergenic
1000994611 5:167946216-167946238 AGCCCAGGGATGGAAGGAATAGG - Intronic
1006162672 6:32047328-32047350 AGCCGAGGGGTGGAAGAAAAGGG - Intronic
1027189100 7:75987661-75987683 AGACCCGGGATGGGAGGAAAGGG + Intronic
1032632521 7:133669256-133669278 AGCCGCGGGATGTAAGGAAAAGG + Intronic
1035372779 7:158390126-158390148 AGCCGGGGGATGAGAGGACAGGG - Intronic
1037783146 8:21885108-21885130 AGCAGCTGGAGGGAAGGAAATGG + Intergenic
1042959104 8:74283966-74283988 AGGGGAGGAATGTAAGGAAAAGG - Intronic
1053534199 9:38909941-38909963 AGGCCCGGGAGGTAAGGAGATGG - Intergenic
1054206423 9:62134360-62134382 AGGCCCGGGAGGTAAGGAGATGG - Intergenic
1054631935 9:67453986-67454008 AGGCCCGGGAGGTAAGGAGATGG + Intergenic
1058414113 9:104767285-104767307 ACCCTAGGGAGGTAAGGAAAAGG + Intronic
1062372401 9:136246854-136246876 AGACGCAGGACGTGAGGAAAAGG - Intergenic
1188180585 X:27050549-27050571 AGTGGCTGGATGTAAGGGAAAGG + Intergenic
1195764977 X:108286541-108286563 AACCATGGGATGTAAGCAAAAGG + Intronic