ID: 1032634579

View in Genome Browser
Species Human (GRCh38)
Location 7:133692944-133692966
Sequence AACAAGGAGGAGGATACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032634579_1032634586 -4 Left 1032634579 7:133692944-133692966 CCTGTTGTATCCTCCTCCTTGTT 0: 1
1: 0
2: 2
3: 23
4: 224
Right 1032634586 7:133692963-133692985 TGTTTTGGATAGGGAAACTGAGG 0: 1
1: 3
2: 17
3: 157
4: 1367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032634579 Original CRISPR AACAAGGAGGAGGATACAAC AGG (reversed) Intronic
900466831 1:2829870-2829892 AGGAAGGAGGAGGATACCCCAGG - Intergenic
900719158 1:4163999-4164021 AACAAGGAGGACCAGAGAACAGG - Intergenic
901774086 1:11547332-11547354 AGCAAGGAGGATGATAGACCTGG + Intergenic
903162226 1:21497254-21497276 AACAAGGAGGAGGAGAAAATGGG + Intergenic
904706686 1:32396133-32396155 AAAAAGGAGGAGGACACCAAGGG - Intergenic
906337823 1:44949476-44949498 AACAAAGAGAAGGAGATAACAGG - Intronic
906822023 1:48939905-48939927 AACTAGGAGGAGGGTGCCACTGG + Intronic
907983509 1:59507947-59507969 AACAAGGAGGAACAGAGAACTGG - Intronic
908350057 1:63277881-63277903 AACAAGGAAGAGGAGGCAAAAGG - Intergenic
910404677 1:86874604-86874626 AACAAGGAGGAGGACAGATGTGG - Intronic
911036851 1:93559542-93559564 AAAAAGGATGAAGATAAAACAGG - Intergenic
911812543 1:102301571-102301593 ATCAAAGAGAAGGATACAAAGGG - Intergenic
912161134 1:106986639-106986661 CACAGGGAGGAGGATACCACAGG + Intergenic
912569887 1:110613648-110613670 TACCAGGAGGAGGATGCACCAGG + Intronic
914702103 1:150144066-150144088 AAGAAGGGAGAGTATACAACAGG + Intronic
914707817 1:150185579-150185601 AGGCAGGAGAAGGATACAACTGG + Intergenic
914912584 1:151799731-151799753 AACAGGGAGGAGGGCACAGCAGG - Intergenic
916550143 1:165842249-165842271 AACATGGAGGGGGAAAAAACAGG - Intronic
918050864 1:180971511-180971533 AGCAGGGAGGAGAATACAGCTGG - Intergenic
918161303 1:181902717-181902739 AACCAGGAGGATGATAAAACTGG - Intergenic
918705848 1:187661049-187661071 AACAAGGACCAGGAAACAAGAGG + Intergenic
920193794 1:204212867-204212889 AACAAGGAGGTGGGTATACCTGG - Intronic
920634848 1:207691778-207691800 AAAGAGGAGGAGGACACAAATGG - Intronic
921557203 1:216612918-216612940 AATAAGCAGGATGATTCAACTGG + Intronic
921650404 1:217671635-217671657 AATAAGGAGGAGGATAGGAGAGG - Intronic
923698137 1:236275052-236275074 AATAAGGAGGACTATACAATAGG + Intronic
923960731 1:239080399-239080421 AACAAGTAGGAGAATGAAACTGG - Intergenic
924029016 1:239868003-239868025 GCCAAGGAGGAGCATAAAACGGG + Intronic
924880329 1:248154381-248154403 ACCAAGGAGAAGAAAACAACTGG - Intergenic
1063886168 10:10581592-10581614 AACAAGAAGGAGGATTGAGCAGG + Intergenic
1064375687 10:14793366-14793388 AACAAGGAGAAGGAAATAAAGGG + Intergenic
1064557998 10:16566699-16566721 AAGAATGGGGAGGAGACAACGGG + Intergenic
1066505372 10:36036795-36036817 AACACGGAGGAGCATAGCACTGG + Intergenic
1067816071 10:49477665-49477687 AGCAAGGAGGAGGGTAGAAGAGG - Intronic
1068370199 10:56103104-56103126 AACAAGGAGGACAACACAACAGG - Intergenic
1069114227 10:64484462-64484484 CACATGGAGGAGGTTCCAACAGG + Intergenic
1069243378 10:66170216-66170238 AATGAGGAGGAGAATGCAACTGG - Intronic
1069523245 10:69143101-69143123 GAAAAAGAGGAGGAAACAACGGG + Intronic
1070045069 10:72825139-72825161 AAAAAAGAGAAGAATACAACAGG + Intronic
1070809566 10:79290827-79290849 AACAGGGAGGAGGAAAAAAATGG - Intronic
1071895546 10:90062608-90062630 CAAAAGGAGGAGGATGCTACTGG - Intergenic
1073150455 10:101307802-101307824 AACAAGGAAGAGGAGGCAAGAGG + Intergenic
1074323470 10:112424901-112424923 AACAAGGAGGAAAACATAACAGG + Intronic
1076209124 10:128626509-128626531 CCCAGGGAGGAGGATACAGCAGG - Intergenic
1080637160 11:34134209-34134231 AACATGGGGGTGGAAACAACTGG + Intronic
1081799986 11:45851822-45851844 AACAACGATGATGATACCACTGG - Intronic
1082678605 11:56141179-56141201 AATAATGATGAAGATACAACAGG - Intergenic
1083573414 11:63772038-63772060 AAGGAGGAGGAGGAGGCAACTGG + Intergenic
1083573422 11:63772087-63772109 AAGGAGGAGGAGGAGGCAACTGG + Intergenic
1084714556 11:70865416-70865438 GACAAGGAGAAGAATACAATGGG + Intronic
1084995122 11:72969114-72969136 GACAATGAGGAGGAGACATCTGG - Intronic
1085823417 11:79817562-79817584 AATAAGGAGGTAGAAACAACAGG + Intergenic
1087457324 11:98403442-98403464 GCCAAGGATGAGGATACACCTGG + Intergenic
1089342697 11:117770148-117770170 CACAAAGAGGAGGATACCGCAGG - Intronic
1089689165 11:120176008-120176030 AATAAAGAGAAGGATAAAACAGG - Intronic
1090424956 11:126601269-126601291 AACAAGGATCAGAAAACAACTGG + Intronic
1090489797 11:127148929-127148951 AACAAGGTAGAGGAAAGAACAGG + Intergenic
1090851718 11:130576530-130576552 GTCAAGGAGGACGATACACCAGG - Intergenic
1090856485 11:130613231-130613253 AGAAAAGAGGAAGATACAACAGG + Intergenic
1091188384 11:133667893-133667915 AACATGGAGAAAGATAAAACTGG - Intergenic
1099056454 12:77847514-77847536 AACAGGGCAGAGGATCCAACAGG + Intronic
1100453375 12:94729098-94729120 AAAAAGGAACAGGACACAACTGG + Intergenic
1100820658 12:98426644-98426666 AACAAGCATTAGGATACTACAGG - Intergenic
1101474450 12:105031455-105031477 AACAAAGAAGGGGAGACAACTGG - Intronic
1104603468 12:130169503-130169525 AACAAAGAGGAGGTTGCAAGGGG + Intergenic
1104616377 12:130273361-130273383 AAGAAGGAGGAGGAGAAAAGAGG - Intergenic
1105025496 12:132845941-132845963 AGCAAGGAGGAGGTAACAACTGG - Intronic
1105062542 12:133166419-133166441 AACAAAATGGAGTATACAACAGG + Intronic
1107354763 13:39555217-39555239 GACAAGGATGAGAATACAAAGGG - Intronic
1107963418 13:45578597-45578619 AACATGGAGGAGGTAAAAACAGG - Intronic
1108582997 13:51843178-51843200 CACAAGGGGGAACATACAACTGG - Intergenic
1111800197 13:92971782-92971804 CACAAGGAGGAGGACAACACAGG - Intergenic
1112751636 13:102589427-102589449 AACAAAGAGGAGCATAGAATTGG + Intergenic
1113225811 13:108158572-108158594 AGCAAGGAGGAGGAAACAGAAGG + Intergenic
1113845127 13:113383402-113383424 CACAAGGAGGAGAATGAAACTGG - Intergenic
1114152562 14:20060670-20060692 AACAAGCAAGAGGATGAAACAGG - Exonic
1115866130 14:37748480-37748502 TACTAGGAGGAGGGTAAAACTGG + Intronic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1117308303 14:54497672-54497694 ATCAAGGAGAAGCATACCACAGG - Intergenic
1117787988 14:59307376-59307398 AACTAGGAAGATGTTACAACTGG - Intronic
1118513176 14:66498880-66498902 AACAAGGAGGCAGAATCAACAGG - Intergenic
1119510895 14:75210284-75210306 AAGAAGGAGGAAGATACAGGGGG - Intergenic
1119850067 14:77860880-77860902 AACAAGGAGCAGGAGGCAGCAGG + Intronic
1120275074 14:82362790-82362812 ACCCAGGAGAAGGATACATCAGG - Intergenic
1121816358 14:96932013-96932035 CACAGGGAGGAGCATACAAGTGG + Intergenic
1124680649 15:31727723-31727745 CACAAGGAGGCAAATACAACAGG - Intronic
1124833502 15:33173213-33173235 TACAAGGAGGAGGACATAATTGG + Intronic
1134114171 16:11535818-11535840 TACAAGCAGGAGGTTAAAACCGG + Intergenic
1135491654 16:22914834-22914856 GGCCAGGAGGAGGATGCAACAGG + Intronic
1137510920 16:49099980-49100002 AACATGTAGGAGAATAAAACTGG - Intergenic
1137931885 16:52596505-52596527 AAGAGGGAGGGGGATAGAACAGG - Intergenic
1140187867 16:72790260-72790282 AACAAAGAGGAGGATCCCACAGG + Intronic
1141386460 16:83626217-83626239 AACGAGGAGGAAGATGAAACCGG - Intronic
1142227695 16:88885545-88885567 AACGAGGAGAGGGATACACCAGG + Intronic
1142880541 17:2879754-2879776 GGCAAGGAGGAGGACCCAACAGG - Intronic
1143295141 17:5865524-5865546 GACCAGGAGGGGGACACAACAGG - Intronic
1144428825 17:15171669-15171691 AACAAGCAGCAGGCTGCAACTGG + Intergenic
1147134419 17:38427003-38427025 AAGAAGGCGGAGGATAAAATAGG - Intergenic
1148211713 17:45812823-45812845 TACAATGAGGAGGAGAAAACAGG - Intronic
1150159444 17:62883298-62883320 AAAAATGAGGAGGGTACAACAGG + Intergenic
1154020090 18:10656508-10656530 AACAGGGAGGAGAATAAAAAAGG - Intergenic
1154962767 18:21326837-21326859 AAAAAGGAGGAGGGAACAACAGG - Intronic
1156879933 18:42064916-42064938 AACAAGGAAGGGGATAAAACTGG - Intronic
1157018792 18:43753879-43753901 AAGGAGGAGGAGGAGAAAACAGG - Intergenic
1157108021 18:44792993-44793015 AACCAGAAGGAGAATCCAACAGG - Intronic
1157308253 18:46532841-46532863 AACAGGGACGAGGATAAACCAGG + Intronic
1157469745 18:47979923-47979945 GACAAGGAGGAGGTTTCAAAGGG - Intergenic
1157983819 18:52414544-52414566 AACAAGGGGGAGAATCCAGCTGG - Intronic
1158565235 18:58549489-58549511 ACCAAGGAGGAGGAAACATCTGG + Intronic
1159041735 18:63330384-63330406 AACAATGAGCAGGATGCAACGGG + Exonic
1159058120 18:63486693-63486715 AAATAGGAGGAGGATGCCACTGG + Intronic
1162173187 19:8807558-8807580 AACAAGGAGGCCAATACAGCTGG - Exonic
1166326998 19:42057136-42057158 GACAGGGAGGAGGAGACAAGTGG + Intronic
927416151 2:22882673-22882695 AACAAGGAGCAGGAAAAGACAGG + Intergenic
927565414 2:24108081-24108103 TACAAAGAGGAGGTTACCACTGG + Intronic
929508146 2:42544779-42544801 AAGAATGAGGAGGATGCAAATGG + Intronic
930008908 2:46919707-46919729 AACAGGGAGTAGGATGCAAAAGG + Intronic
930050889 2:47215492-47215514 AGCAAGGAGGAGGAAAAAAGTGG + Intergenic
930195756 2:48508177-48508199 ACCAAGGAGTAGGAAACAAATGG + Intronic
930317394 2:49814295-49814317 AAGAAGGAGGAGGATAAAGAGGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931988639 2:67766896-67766918 ATCATGGAGAAGGATACAAGAGG + Intergenic
932213735 2:69952876-69952898 AACATGGAGGACGAACCAACAGG - Intergenic
933303817 2:80572904-80572926 AAAAAGGAGGGGGAGACAGCAGG - Intronic
934524902 2:95045714-95045736 AAATAGGAGGAGGATCCAGCGGG - Intronic
934970790 2:98762537-98762559 AAAAAGGAGGAGGACACAAAAGG - Intergenic
935373291 2:102369888-102369910 AAGAAGGAAGGGGATACAAAAGG + Intronic
937486808 2:122323972-122323994 AACAAGGCTGAGGAGACAAACGG + Intergenic
937541936 2:122966347-122966369 AACAAGGATGTGGTTACTACTGG - Intergenic
939249415 2:139665728-139665750 AACAAGGAGGAGGATTCAAGAGG + Intergenic
939525355 2:143287462-143287484 AACAAAGAGGAAGATAGAATGGG + Intronic
940243096 2:151584572-151584594 AATAAGAAGGAGGAAACAACTGG + Intronic
940244051 2:151595124-151595146 AATAAGAAGGAGGAAACAACTGG + Intronic
940245010 2:151605677-151605699 AATAAGAAGGAGGAAACAACTGG + Intronic
944003788 2:194876859-194876881 AAGAAGGAGGAGGCTTCAACAGG - Intergenic
944131937 2:196356258-196356280 AACAATGAGGAGAGTAAAACAGG + Intronic
945142708 2:206703861-206703883 AACAAGGGTAAGGGTACAACAGG + Intronic
945889728 2:215416779-215416801 CACAAGGAGGAGGATAAAAATGG + Intronic
946677091 2:222171694-222171716 GAGAAGGAGGAGGAAACCACAGG - Intergenic
947077030 2:226355822-226355844 AACAAGGAGGAGGACAGAGAGGG + Intergenic
947520054 2:230838642-230838664 AACAAGGAGGAGGAAGTAAGTGG - Intergenic
1169801827 20:9518482-9518504 AAGAAGAAGGAGGAAACAAAGGG - Intronic
1170268891 20:14501336-14501358 AAAAAGGAGAATGATATAACTGG - Intronic
1173624451 20:44462029-44462051 AACATGGAGGAGGATGTAAGGGG + Exonic
1174407886 20:50313848-50313870 AAGAAGGAGGAGGAGGCACCTGG + Intergenic
1180626846 22:17199286-17199308 AACAAGGGGGAAGATGGAACAGG + Intronic
1181041163 22:20193313-20193335 ACCAAGGAGGAGGACACAGAAGG - Intergenic
1181758595 22:25042307-25042329 AATAATGAACAGGATACAACAGG - Intronic
1182629557 22:31674700-31674722 TAGAAGTAGGAGGACACAACCGG - Intergenic
1183992537 22:41607612-41607634 TACAGGGAGGAGGATGCTACTGG - Intronic
1184159879 22:42691897-42691919 AAAAAGGAGGAGGGAAAAACAGG + Intergenic
950971604 3:17194326-17194348 AACATGGAGTAGGATGCAGCGGG + Intronic
951427598 3:22565502-22565524 AACCAGGAGGATGATAAAGCTGG + Intergenic
952941552 3:38448914-38448936 AAGAGGGAGCAGGATACAACAGG - Intergenic
954517556 3:51192281-51192303 AACAAGCAGAAGAATGCAACAGG - Intronic
954559025 3:51539839-51539861 AACATTGAGGTGGATGCAACTGG + Intergenic
955556131 3:60139425-60139447 AACAAGGTGGAGGATATAGCTGG + Intronic
956984347 3:74679895-74679917 AAGAAGGAGGAAGAGACAGCAGG + Intergenic
962693348 3:137923780-137923802 AGCATTGAGGAGGAAACAACAGG + Intergenic
967035816 3:185647578-185647600 AACGAGGAGGAGGGAACAGCAGG - Intronic
967313060 3:188124739-188124761 AACAAGCTGAAAGATACAACTGG + Intergenic
968025628 3:195440347-195440369 ATCAATGAGGAGAATACAAGGGG - Intronic
968533619 4:1110324-1110346 ACCAAAGAGGAGAAAACAACAGG + Intronic
974403699 4:61438313-61438335 AAAAAGGAAGGAGATACAACAGG - Intronic
974767147 4:66361677-66361699 AACAAGGACGAGGTGACAAAAGG + Intergenic
976501169 4:85791085-85791107 AAAAAGGGGAAGGACACAACAGG - Intronic
980484642 4:133440085-133440107 AAAAAGGAGGAATATAGAACAGG + Intergenic
983282716 4:165701303-165701325 AACTGGAAGGAGGATAAAACAGG + Intergenic
984012683 4:174389441-174389463 TACAAGGAGGAAGATTCAGCTGG - Intergenic
986595879 5:9421159-9421181 AACATGGAGGAAGATACAGAAGG - Intronic
990466758 5:56078303-56078325 AGCAAAGAGGAGGATAGAAATGG - Intergenic
991271062 5:64781773-64781795 TATAAGAAGGAGGATACAAAAGG + Intronic
992946373 5:81814822-81814844 AAGAAGGAGGAGAATAAGACTGG + Intergenic
993579561 5:89643108-89643130 AACAAAGAAAAGGACACAACTGG + Intergenic
993790354 5:92200396-92200418 AAGAAGGTGGAGGATAAAAGAGG - Intergenic
994331604 5:98512822-98512844 AACATGGAGGAGCATAACACAGG - Intergenic
995326623 5:110896912-110896934 ACCAAGAAGGAGGAAACAACTGG + Intergenic
998717602 5:144903506-144903528 AACATGGAGGAGATTACAAATGG + Intergenic
998746314 5:145263816-145263838 AACAAGCAGCAGGATAGAAATGG + Intergenic
999246137 5:150155746-150155768 AACAAGGAGGAGGAGAGAGCCGG - Exonic
999656024 5:153811342-153811364 CACAAGAAGGATGATTCAACAGG + Exonic
1001713120 5:173793895-173793917 AAAAAGGAGGAGGAAAAATCAGG - Intergenic
1003128572 6:3376227-3376249 AAGAAGGAGGAGGAGGCAGCTGG - Intronic
1003432814 6:6055701-6055723 AACAATGAGGAAGAGACAAGAGG - Intergenic
1003718464 6:8673865-8673887 AAACAAGAGGAAGATACAACAGG + Intergenic
1004342538 6:14820141-14820163 AACAAGTAGCAGGAAACAAATGG - Intergenic
1005529337 6:26687072-26687094 AACAAGGAGAAAGTCACAACGGG - Intergenic
1005541459 6:26814574-26814596 AACAAGGAGAAAGTCACAACGGG + Intergenic
1008528221 6:52429389-52429411 CACAAGTAGGAGAATAAAACTGG - Intronic
1009012265 6:57856636-57856658 AACAAGGAGAAAGTCACAACGGG + Intergenic
1009821555 6:68808733-68808755 AAAAAGGAGGAGGAAAAAAGGGG + Intronic
1011726185 6:90212741-90212763 AATAAAGAGGAGGAAACAAGAGG + Intronic
1012547802 6:100439613-100439635 AACAATGAGGAATATACAAAAGG + Intronic
1014654351 6:124080766-124080788 AAGAAGGAAGAGGATATAAAAGG - Intronic
1016241527 6:141937136-141937158 GAAAAGGAGGAGGATACTCCAGG + Intergenic
1017956837 6:159185663-159185685 AAAAAGGAGGAAGGTACAAAAGG + Intronic
1018395694 6:163376524-163376546 AACAAGGAGGAGGAGAAAGAGGG + Intergenic
1020089568 7:5331277-5331299 AAATAGGAGGAGGAAGCAACTGG + Intronic
1023738057 7:43252006-43252028 AAACAGGAGGAGGATACTGCTGG - Intronic
1024407795 7:49002422-49002444 AACACGGAAGAGGATGCAGCAGG + Intergenic
1027661740 7:80996089-80996111 AACAAGGAGGAGGATGGCCCAGG + Intergenic
1028039122 7:86025643-86025665 AAGAAGGACAGGGATACAACTGG + Intergenic
1030258581 7:107539262-107539284 AACACTGAGGAGGAAAAAACTGG - Intronic
1031609565 7:123809032-123809054 GACAAGAAGGAGGATATAATTGG + Intergenic
1032634579 7:133692944-133692966 AACAAGGAGGAGGATACAACAGG - Intronic
1033576922 7:142694399-142694421 ATCCAGGAGGAGCATACAAGGGG - Intergenic
1035203985 7:157282670-157282692 AACAAGGAGGCTAATACAGCCGG + Intergenic
1035538852 8:416047-416069 AACAAGGAGGAGCAAGCAATGGG - Intronic
1041380208 8:57246946-57246968 AAAAAGGAGCAGGAAAAAACTGG + Intergenic
1042192152 8:66197935-66197957 AACAAGGTGGAGGAAGCCACAGG + Intergenic
1046158384 8:110325130-110325152 TAGAAGGAGGAGGAGAGAACAGG - Intergenic
1046389015 8:113543225-113543247 AACAAGGAGGATGATACACCTGG - Intergenic
1046453051 8:114419104-114419126 AACAAAGAGGATGTTACCACAGG + Intergenic
1046616903 8:116487902-116487924 GACAAGGTGGAGGATAAAATAGG - Intergenic
1046750622 8:117922979-117923001 AAGAAGCAGGAGGATGCAAGAGG + Intronic
1047315356 8:123728008-123728030 AAGAAGCAGGAGGTGACAACAGG - Intronic
1047445493 8:124915495-124915517 ATCAAGGATGAGGATACACAGGG - Intergenic
1048290493 8:133177728-133177750 GAAAAGGAGGAGGATAAAAGAGG - Intergenic
1048609831 8:136010100-136010122 GAGAAGGAGAAGGATGCAACTGG - Intergenic
1050024582 9:1320663-1320685 AAGAAGGAGAAGGAGAAAACGGG + Intergenic
1051358034 9:16257704-16257726 AACCAGGAGGAGGAAAGATCTGG - Intronic
1053556623 9:39144726-39144748 AACAGGGAGGAAGATACAGAGGG + Intronic
1053754028 9:41284971-41284993 TGCAAGGTGGAGGATACACCTGG - Intergenic
1053820735 9:41965009-41965031 AACAGGGAGGAAGATACAGAGGG + Intronic
1054089602 9:60833148-60833170 AACAGGGAGGAAGATACAGAGGG + Intergenic
1054111013 9:61108706-61108728 AACAGGGAGGAAGATACAGAGGG + Intergenic
1054259546 9:62849333-62849355 TGCAAGGTGGAGGATACACCTGG - Intergenic
1054332226 9:63770705-63770727 TGCAAGGTGGAGGATACACCTGG + Intergenic
1054609844 9:67222419-67222441 AACAGGGAGGAAGATACAGAGGG - Intergenic
1055155601 9:73059044-73059066 AACAAGGATGAGAATAAAACTGG + Intronic
1055700908 9:78944726-78944748 AACCAGGAGGAGGAGAATACTGG - Intergenic
1057379600 9:94555815-94555837 GACAAGGAGGAGGAGAAAAGAGG + Intergenic
1057561620 9:96132445-96132467 AACAAGGAAGATGTTAGAACTGG + Intergenic
1058337105 9:103843712-103843734 CACAAGGATGAGGTTACAAGTGG + Intergenic
1058633722 9:107016486-107016508 AACAAGGAGGAGGGAGGAACTGG + Intergenic
1060186785 9:121568478-121568500 AAGGAGGAGGAGAATACAAAGGG + Intronic
1186086603 X:5996891-5996913 AAAAAGGATGAGGATAGACCGGG - Intronic
1186290825 X:8096754-8096776 AACAAGGTGGATGATTCCACAGG - Intergenic
1186466960 X:9790839-9790861 AACAAGGATGAGAATTCAGCAGG - Intronic
1189695480 X:43657387-43657409 AGGAGGAAGGAGGATACAACAGG - Intronic
1191012955 X:55779771-55779793 AACACGTAGGAGGATGAAACTGG + Intergenic
1192343872 X:70285329-70285351 AGCAAATAGGAGGATAGAACAGG + Intergenic
1193910420 X:87299164-87299186 AAGAAAGAGGAGGACAGAACAGG - Intergenic
1194241199 X:91451534-91451556 AACTAAGAGGATGATAAAACGGG - Intergenic
1195690712 X:107622329-107622351 AAAAAGGAGGAGGTGACAACAGG + Intergenic
1196105637 X:111892119-111892141 AACATAGAGGAGGCCACAACTGG + Intronic
1197697905 X:129570498-129570520 AAACAGGAGCAGGATAAAACAGG - Intronic
1198033351 X:132777070-132777092 AACTAGGAAGGGGGTACAACTGG + Intronic
1198221682 X:134608516-134608538 GGCAAGGAGGAGGGAACAACAGG + Intronic
1198329520 X:135609037-135609059 ATAAAGCAGGAGGATACACCAGG - Intergenic