ID: 1032634669

View in Genome Browser
Species Human (GRCh38)
Location 7:133693552-133693574
Sequence CTGTGTAATTAGGAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032634669_1032634671 15 Left 1032634669 7:133693552-133693574 CCATCACACTCCTAATTACACAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1032634671 7:133693590-133693612 GCCACGATTCAAACAAACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 69
1032634669_1032634673 30 Left 1032634669 7:133693552-133693574 CCATCACACTCCTAATTACACAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1032634673 7:133693605-133693627 AACCCAGGCAATCTGATTCCAGG 0: 1
1: 6
2: 36
3: 136
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032634669 Original CRISPR CTGTGTAATTAGGAGTGTGA TGG (reversed) Intronic
900024780 1:261718-261740 CTTTATAATTAGGTGTGTGTAGG + Intergenic
900028388 1:351123-351145 CTTTATAATTAGGTGTGTGTAGG + Intergenic
901847838 1:11995719-11995741 ATGTGTAAGGAGGAGCGTGATGG + Intronic
903771750 1:25768621-25768643 GTGTGTAATTGTGTGTGTGAGGG - Intronic
904102633 1:28045328-28045350 CTATGTAAGTAGGTGTGAGATGG - Intronic
906127928 1:43439045-43439067 CTGTGTACTTGGGAGAGTGCAGG - Exonic
907988589 1:59556957-59556979 CTTTGTACTTGGGAGTGGGAAGG + Intronic
908200738 1:61792864-61792886 CTGGGTAATTAGGGGTGGCAGGG + Intronic
910549985 1:88464736-88464758 CTTTGTACTTAGGAGAGTCAGGG - Intergenic
910770575 1:90827150-90827172 CTGTGAAAGTTGGAGTTTGAGGG + Intergenic
912994206 1:114517068-114517090 CTCATTAATTAGAAGTGTGACGG + Intergenic
913279227 1:117170043-117170065 CTGAGTGATTAGGAGTTTAATGG + Intronic
913452754 1:119003259-119003281 CTGCTTAATCAGGAGGGTGATGG - Intergenic
914865521 1:151424791-151424813 CTGTGTACTTTGGAATGTGATGG - Intronic
915624985 1:157108984-157109006 CTGTGTAACGAGGAGAGTGGAGG - Intergenic
918167374 1:181963041-181963063 CTTTGTAATAAGTTGTGTGATGG - Intergenic
920126225 1:203695653-203695675 CTATGCAGTTAGGGGTGTGAGGG - Intronic
920915940 1:210258046-210258068 CTAAGAAATTAGGAGTGTCACGG + Intergenic
920954729 1:210608029-210608051 CTGTGTAATCAGGAATGATATGG + Intronic
921585034 1:216936145-216936167 CTCTGTAGTCAGGAATGTGAAGG + Intronic
922184249 1:223259916-223259938 CTGTGTATTTTGAAGTGTGGTGG - Intronic
1062820845 10:533525-533547 CAGTGTGTTCAGGAGTGTGAAGG + Intronic
1063396766 10:5695456-5695478 GTGTGTAATTAGGGCTGTGGTGG + Intronic
1064735944 10:18381733-18381755 CTGTAGAATTTGGAATGTGAAGG + Intronic
1064821985 10:19347126-19347148 CTGTGTAATTACTACTGTCATGG + Intronic
1066027447 10:31375648-31375670 CTGTGTATGTTGGAGTGTAATGG + Intronic
1067936684 10:50618764-50618786 GTATGTACTTAGGAGTGGGATGG - Intronic
1068217145 10:53997272-53997294 CTCTATAATGAGGACTGTGAAGG + Intronic
1071785779 10:88898133-88898155 CTTAGTAATTAAGAGTGTAAAGG - Intronic
1072030805 10:91520319-91520341 CTGTGTAGTTTGGAGTGGAAAGG - Intergenic
1074695319 10:116045358-116045380 CAGTGTAATAAGGTGTTTGATGG + Intergenic
1076581011 10:131511023-131511045 TTGTGTAGGTAGGAGAGTGATGG + Intergenic
1078459915 11:11506672-11506694 CTGTGTTATTAGAAAAGTGAAGG + Intronic
1080841085 11:35984161-35984183 TTTTGCAATTAGTAGTGTGAGGG - Intronic
1081648029 11:44803486-44803508 TTCTGTCATTAGGAGTCTGAAGG + Intronic
1081997751 11:47376090-47376112 GTGTGGGATTATGAGTGTGAGGG - Intronic
1083528546 11:63395923-63395945 TTGTGTATTTAGGAGTATTATGG + Intronic
1085131028 11:74038749-74038771 GTGTGAAATGATGAGTGTGAAGG - Intronic
1085350510 11:75795409-75795431 CTGTGTTACAAGGAATGTGATGG - Intronic
1089127512 11:116187221-116187243 CTGTGTAATTCTGGGTGTGGTGG + Intergenic
1091780384 12:3210207-3210229 CTGGGTATATAGGAGTGTAATGG + Intronic
1095980065 12:47967517-47967539 CTGTCTCATTAGGATTCTGAGGG - Intronic
1097971749 12:65640357-65640379 CAGTTTAAATAGGAGAGTGAAGG + Intergenic
1099358906 12:81673197-81673219 GTGTGTAACCAGCAGTGTGAAGG - Intronic
1099600336 12:84727736-84727758 CAGTATAATTAAGTGTGTGAAGG - Intergenic
1099948969 12:89278771-89278793 CCGTTGAATAAGGAGTGTGAGGG - Intergenic
1100554485 12:95679566-95679588 CTGGGTAAATAGGGATGTGAGGG - Intronic
1101545457 12:105707931-105707953 CCCCGTAAGTAGGAGTGTGAAGG - Intergenic
1104603581 12:130170727-130170749 ATGTTTTATTAAGAGTGTGAAGG + Intergenic
1105343660 13:19552811-19552833 CTATTTAATTATGAGTGTCAAGG - Intergenic
1105536384 13:21268823-21268845 CTATTTAATTATGAGTGTCAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105796378 13:23858031-23858053 CTGTTTAAGTAGGAGAGTTAAGG - Intronic
1106453621 13:29907759-29907781 CTGAGGAGTTGGGAGTGTGAGGG - Intergenic
1107131151 13:36897118-36897140 TTATGTAATTAGAACTGTGAAGG - Intronic
1107372632 13:39769182-39769204 ATGTGTACATAGGAGTGTTATGG - Intronic
1111415390 13:87935068-87935090 CTGTGTAATAAAGATTTTGAAGG - Intergenic
1111519770 13:89385493-89385515 ATGTGTCATTAGGAGTTAGAGGG - Intergenic
1113754521 13:112801690-112801712 CTGTGTAATTTGGTGGGTGGGGG - Intronic
1115259702 14:31438911-31438933 CTTTTTAATTCTGAGTGTGAGGG + Intronic
1115405836 14:33015147-33015169 CAATGTATTTAGGAGTGAGATGG + Intronic
1117648942 14:57882218-57882240 CAGTGTAATTAGGAATGGAAGGG - Intronic
1117824799 14:59690218-59690240 CTGTGTCATTATGTGTGAGATGG - Intronic
1121146370 14:91586381-91586403 CTGTCACATGAGGAGTGTGAAGG - Intronic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1123809218 15:23906535-23906557 CTGGGTATTGGGGAGTGTGATGG - Intergenic
1123829082 15:24115448-24115470 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123832888 15:24159836-24159858 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123839611 15:24234739-24234761 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123844002 15:24278892-24278914 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123849479 15:24340535-24340557 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123852676 15:24376498-24376520 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123859079 15:24445174-24445196 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123868534 15:24548053-24548075 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1127010686 15:54624016-54624038 CTGAGGGATTTGGAGTGTGAAGG + Intronic
1127041907 15:54986389-54986411 ATTTGTAATTAGGACTGTTAGGG + Intergenic
1130200078 15:81817499-81817521 CTGTACAATTAGGAGTGGGATGG + Intergenic
1130437750 15:83918981-83919003 GTGGGTAAGCAGGAGTGTGATGG + Intronic
1131087722 15:89591006-89591028 CTCTGTATTGGGGAGTGTGAGGG - Intronic
1136640255 16:31558060-31558082 CAGTGTAACTAGTAGTGTTACGG - Intergenic
1137025057 16:35465742-35465764 CAGTGTAAGTAGTAGTGTCAGGG - Intergenic
1139141547 16:64269251-64269273 CTGTGTAATTAGGAATAGGGAGG + Intergenic
1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG + Intergenic
1142456372 16:90227660-90227682 CTTTATAATTAGGTGTGTGTAGG - Intergenic
1144334491 17:14256576-14256598 CTGTGGATTTAGCAGTGTGGAGG - Intergenic
1144766149 17:17733824-17733846 CAGTGTAATTTGGGCTGTGAGGG + Intronic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1150075115 17:62185537-62185559 ATGGGTGATTAGGAGTTTGAGGG - Intergenic
1150830535 17:68514397-68514419 CTTAGTAATTAGGAGTTGGAAGG + Intronic
1151009465 17:70476808-70476830 CTTTTTAATAAGAAGTGTGATGG - Intergenic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1155265316 18:24086834-24086856 CTGTCTAAGTAAGGGTGTGATGG + Intronic
1157723114 18:49941148-49941170 GTGAGAAATGAGGAGTGTGAGGG - Intronic
1158645253 18:59240360-59240382 CTGTGTACTTGGGACTATGATGG - Intergenic
1160654354 19:254976-254998 CTTTGTAATTAGGTGTGTAAAGG + Intergenic
1161093048 19:2372555-2372577 CTCTGAGATTAGCAGTGTGAAGG + Intergenic
1161482896 19:4519563-4519585 CTGTGTTATTGGGGGTGAGAGGG + Intergenic
1165744862 19:38224510-38224532 GTGTGTGAGTAGGAGTGTGTGGG - Intronic
1166427717 19:42694288-42694310 CTGTTTAATTAGCATTGTGCTGG - Intronic
927869000 2:26611794-26611816 CTGTGTAATTATCATTTTGATGG - Intronic
928231810 2:29505046-29505068 CAGTGTGGTTAGGATTGTGAAGG + Intronic
929123626 2:38503386-38503408 CTATGCATTTAGGAGTGTGTTGG - Intergenic
929956341 2:46461250-46461272 CTGGATCATTTGGAGTGTGATGG + Intronic
937692380 2:124771076-124771098 CTGTGTAATGCGGACTTTGATGG + Intronic
938906625 2:135842824-135842846 CTGTGAAATTAGGTGAATGAGGG + Intronic
939408027 2:141785050-141785072 CTGTGAAGTTAGGAGGGAGAAGG - Intronic
939917823 2:148069569-148069591 CTGGGTAATAAGGAGTTTGTGGG + Intronic
940075436 2:149736417-149736439 ATATGTAATTTGGAGTCTGAAGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
941405321 2:165079976-165079998 CAGTGTAGTTGGGAGTGTGGTGG + Intergenic
944353679 2:198759597-198759619 CTGTGAAATAAGGGGTGAGAAGG + Intergenic
945758222 2:213877347-213877369 CTGTGTAGTCAGGAGTGTGGTGG + Intronic
946964421 2:225022505-225022527 ATGTGTGGTTAGGAGAGTGATGG - Intronic
947991149 2:234488483-234488505 CTATGTAATTTGAAGTGTGCTGG - Intergenic
949087865 2:242172454-242172476 CTTTATAATTAGGTGTGTGTAGG - Intergenic
1168902637 20:1377943-1377965 TTGTTTAATTAGGAAGGTGAGGG - Intronic
1169923755 20:10761603-10761625 CTGAGTTATTAGGTGGGTGATGG - Intergenic
1170223735 20:13967726-13967748 CTGTGAAATGAAGAGGGTGACGG + Intronic
1174260054 20:49287420-49287442 ATGGGTAATTAGGAGTGGGAAGG + Intergenic
1176940889 21:14924286-14924308 CTGTGTGATTTGGAGTGAGAGGG - Intergenic
1181486517 22:23234987-23235009 CTGAGAAATCAAGAGTGTGAGGG - Intronic
1182171657 22:28236138-28236160 CTGCGGAACTAGGATTGTGAAGG - Intronic
1182867518 22:33617014-33617036 CTGTGTATTTGGGAGAGGGAAGG + Intronic
1184595021 22:45508617-45508639 CTGTTTCCTTTGGAGTGTGATGG + Intronic
954092698 3:48297731-48297753 CTGTGGGATTAGAATTGTGAAGG + Intronic
955299942 3:57768600-57768622 GAGGGTAATTAGGAATGTGATGG + Intronic
955954255 3:64272343-64272365 ATGTGTAATTGGGAATCTGAAGG - Intronic
957340893 3:78895128-78895150 AAGTATAATTTGGAGTGTGAAGG + Intronic
957768240 3:84654747-84654769 ATGTGTAAAGAAGAGTGTGAAGG + Intergenic
958197504 3:90260448-90260470 TTTTGGAATTAGGAGTTTGATGG + Intergenic
960610062 3:119547592-119547614 CTGTGTAGTGAGGAAAGTGAGGG - Intronic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
967194876 3:187017468-187017490 CTGTGAGATTAGGGGTGGGAGGG + Intronic
967440133 3:189497943-189497965 GTGTGTAAATGGGAGTGTGGAGG + Intergenic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
969800005 4:9556487-9556509 AAGTGAAATGAGGAGTGTGAAGG + Intergenic
970503175 4:16699502-16699524 TTGTGTAATTAGGTATATGATGG + Intronic
972662437 4:41129333-41129355 CTGTGTAGTCAGGAGGGTGTTGG - Intronic
974915814 4:68176962-68176984 CTCTGTGATTAGGATTGTGAAGG + Intergenic
976495388 4:85723517-85723539 CTGTGTAATATGGAATATGAAGG + Intronic
977286799 4:95117835-95117857 CAGTCCAGTTAGGAGTGTGAAGG + Intronic
978173210 4:105698915-105698937 CTGAGTGATTTGGAGTTTGAGGG + Intronic
980651758 4:135726092-135726114 CTGTGTACATAGCAGTGTCAGGG - Intergenic
980792909 4:137642650-137642672 CTGTGGAACTTGGGGTGTGAGGG + Intergenic
984076200 4:175183550-175183572 ATATGTAATTAGGAATCTGAAGG - Intergenic
984849422 4:184141215-184141237 CTGTCTAATCAGGAGTCTGTGGG + Intronic
987684032 5:21173520-21173542 CATTGTAATTAGGAATGTAAAGG + Intergenic
987715483 5:21563920-21563942 TTGTGTAATTAGTAGGGTGGTGG + Intergenic
988252684 5:28780693-28780715 CTTAATAATTAGGAGTGTCATGG + Intergenic
988666062 5:33329034-33329056 GTGTTTATTTAGGTGTGTGATGG + Intergenic
989360709 5:40598286-40598308 ATGTGGAATCAGGAGTGTGTTGG + Intergenic
990722259 5:58709873-58709895 CTCTCTAATTAGCTGTGTGATGG + Intronic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
995295187 5:110512082-110512104 CTCTGTAATGATGAGTATGATGG - Intronic
995441796 5:112200322-112200344 CTGTGTAATGAGCACTGTTAGGG - Intronic
996485899 5:124033792-124033814 CTGATTAAATAGGAGTGTGTTGG + Intergenic
996746562 5:126851269-126851291 CTGGTTAATTTGGAGTTTGAGGG + Intergenic
1001416716 5:171549966-171549988 CTCTTTAATTAGGAGAGGGAAGG + Intergenic
1001437821 5:171714334-171714356 CTGAGTGATTAGGGGTGAGAAGG - Intergenic
1001552714 5:172616092-172616114 ATGTGTAATTAGAGGAGTGAAGG + Intergenic
1001860008 5:175046058-175046080 CTTTGTGTTTAGGCGTGTGAAGG + Intergenic
1002099092 5:176848563-176848585 CTGTCTCATCAGGGGTGTGATGG + Intronic
1002745602 5:181469248-181469270 CTTTATAATTAGGTGTGTGTAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003470054 6:6421168-6421190 CTGTGAAATGAGGACTGTGATGG - Intergenic
1005092914 6:22078066-22078088 CTGTGTTCTAAGGAGTGTTAAGG + Intergenic
1005845525 6:29774097-29774119 GTGTATGATTAGGAGTGGGATGG - Intergenic
1009001240 6:57718124-57718146 TTGTGTAATTAGTAGGGTGGTGG - Intergenic
1010649589 6:78436466-78436488 CTTTGTAAATAGGGGTGAGATGG - Intergenic
1011045607 6:83078559-83078581 TTGTGTAATTAGGAAGATGATGG + Intronic
1012089782 6:94876353-94876375 CAGTGTGATTAGGAGTGAGAAGG + Intergenic
1013010595 6:106116520-106116542 CTGTGGAGTTAGAAGTGAGATGG - Intergenic
1014776850 6:125520943-125520965 TTGTGTATTTAGGGGTGGGATGG - Intergenic
1018583167 6:165325396-165325418 CTGTGAAATCAGGAATGTTAGGG - Intergenic
1019250519 6:170742803-170742825 CTTTATAATTAGGTGTGTGTAGG - Intergenic
1020273117 7:6608451-6608473 CTGTGTGGCGAGGAGTGTGACGG + Exonic
1020763876 7:12297574-12297596 CAGTGGATTTTGGAGTGTGAAGG + Intergenic
1021236634 7:18150310-18150332 CTGTGTAATTTAAAGAGTGATGG + Intronic
1021295234 7:18896829-18896851 CAGTGGAATTTGCAGTGTGAAGG - Intronic
1023897370 7:44445136-44445158 CTGTGTTCTTTGGAGTGTAAGGG - Intronic
1026446510 7:70488912-70488934 CTGTGTACTAGGGAATGTGATGG - Intronic
1032634669 7:133693552-133693574 CTGTGTAATTAGGAGTGTGATGG - Intronic
1035746741 8:1966469-1966491 TTGTGTACTTAGGAGGGTGCGGG - Intergenic
1037711117 8:21356179-21356201 CTGTGTGATAAATAGTGTGATGG - Intergenic
1039584048 8:38690787-38690809 CTGTGCAAATAAGATTGTGATGG - Intergenic
1041461694 8:58118632-58118654 CTTTGTAACTAAAAGTGTGAAGG - Intronic
1044290336 8:90461310-90461332 GTGTGGTATTAAGAGTGTGATGG - Intergenic
1045827345 8:106414327-106414349 CTGTGTAATTCCGAGAGGGAAGG + Intronic
1048340329 8:133533715-133533737 CTGTGAAATTAGGAGTGGAAGGG - Intronic
1048871816 8:138805186-138805208 GTGTGTGATTGGGTGTGTGATGG + Intronic
1053288529 9:36865122-36865144 CTCTGTATTTAGGAGTGGGGAGG - Intronic
1055779902 9:79809227-79809249 CTGTGTGCTTAGAAGTGTGTTGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058493742 9:105531308-105531330 ATGTGTAATCAGGAGTGAGGAGG - Intronic
1059297013 9:113280197-113280219 ATTTGTTATTAGGAGAGTGAAGG - Intronic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1203580074 Un_KI270745v1:35402-35424 CTTTATAATTAGGTGTGTGTAGG - Intergenic
1189405514 X:40719290-40719312 CTGTATACCTAGGAGTGGGATGG - Intronic
1193012007 X:76687253-76687275 CTGTGTGATTAGCTGTGAGATGG + Intergenic
1193107119 X:77688594-77688616 CTGTGTAAATAGGATTTGGATGG - Intronic
1193611716 X:83639781-83639803 CTGTGTCATAAGGAGTGTGTTGG - Intergenic
1195849259 X:109265124-109265146 CTGTGTTCTAGGGAGTGTGAGGG - Intergenic
1196037621 X:111163896-111163918 CTGTCAAATTAGGAGTGGAAGGG - Intronic
1198654491 X:138898805-138898827 CTGTGCAATTGGCAGTTTGAGGG + Intronic
1202082704 Y:21100994-21101016 CTGGCTACTTAGGAGGGTGAGGG + Intergenic