ID: 1032635923

View in Genome Browser
Species Human (GRCh38)
Location 7:133708707-133708729
Sequence TTACACAGCTTGTAAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 9, 3: 54, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032635922_1032635923 7 Left 1032635922 7:133708677-133708699 CCAAACTGAGTCTCAGTAAGTTG 0: 1
1: 0
2: 2
3: 7
4: 145
Right 1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG 0: 1
1: 0
2: 9
3: 54
4: 336
1032635920_1032635923 22 Left 1032635920 7:133708662-133708684 CCCATTTAAAGATGACCAAACTG 0: 1
1: 4
2: 21
3: 591
4: 4482
Right 1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG 0: 1
1: 0
2: 9
3: 54
4: 336
1032635921_1032635923 21 Left 1032635921 7:133708663-133708685 CCATTTAAAGATGACCAAACTGA 0: 1
1: 2
2: 34
3: 461
4: 1525
Right 1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG 0: 1
1: 0
2: 9
3: 54
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032635923 Original CRISPR TTACACAGCTTGTAAGTAAC TGG Intronic
900731035 1:4260040-4260062 CTACACAGCTACTAAGTAGCAGG - Intergenic
903236188 1:21952277-21952299 TCACACAGCTTGTAAGTGGTGGG + Intergenic
903509252 1:23861769-23861791 TGACAAGGCTTGTAAGTAACAGG + Intronic
903589374 1:24442502-24442524 TGACACAGCTAGTGAGTAACAGG + Intronic
903606197 1:24576670-24576692 TCACACAGAAAGTAAGTAACAGG + Intronic
903804571 1:25995985-25996007 TCACACAGCTAATAAGTGACAGG - Intronic
904251776 1:29230343-29230365 TCACACAGCCAGTAAGTGACAGG - Intronic
904875720 1:33653086-33653108 TCACACAGCTAGGAAGTAGCAGG - Intronic
905258148 1:36698754-36698776 TCACACCGCTTGTAAATAGCAGG - Intergenic
905443794 1:38011558-38011580 TCACACAGCCTGTAAGTGAATGG + Intronic
906945873 1:50293715-50293737 TCACACAACTAGAAAGTAACAGG - Intergenic
907072570 1:51550062-51550084 TTAAACAGCTAGTAAGGGACAGG - Intergenic
907578140 1:55547147-55547169 TTCCACAGCTTGGAAGTTACAGG - Intergenic
907632638 1:56098521-56098543 TCACACAGCTATTAAGTAGCAGG + Intergenic
907712157 1:56893634-56893656 TTACACAGTTAGTAAGTGGCAGG - Intronic
908005833 1:59727916-59727938 TTAGACAGGTTATAAGTAAAGGG - Intronic
908264465 1:62364537-62364559 TTTCACAGTCAGTAAGTAACAGG - Intergenic
908281450 1:62541213-62541235 ATGCACAGCTTGTAGGTAGCAGG - Intronic
908474803 1:64477035-64477057 TTACACAGTTAATAACTAACTGG - Intronic
908767193 1:67564802-67564824 TCACACAGCTAGTAAGTGGCAGG + Intergenic
910270104 1:85385678-85385700 TCACACAACTAGTAAGTAAGTGG - Intronic
911713528 1:101102937-101102959 TCACACAGCTTGCAAGTGATGGG - Intergenic
912544235 1:110439539-110439561 TCACACAGATAGTAAGTCACAGG - Intergenic
912737865 1:112166066-112166088 TTACATAGCTAGAAAGTAAGGGG + Intergenic
912926366 1:113916710-113916732 ATACACAGCTAGTAAGTCACAGG - Intergenic
912959479 1:114182382-114182404 TCACACAGCTTGTACGTAGCAGG - Intergenic
913163381 1:116165268-116165290 TCACACAGCTAGTAAGTGGCAGG + Intergenic
914326344 1:146620649-146620671 TTACAGAGCTAGTAAGTCAATGG + Intergenic
916908774 1:169320951-169320973 TAACACAGCTAGAAAGTAAAGGG - Intronic
917084103 1:171288407-171288429 TCACACAGCTAGTAAGTGGCAGG - Intergenic
918157644 1:181864796-181864818 TTAGACAGCCTGTTAGTAAATGG - Intergenic
918453620 1:184684970-184684992 TTACACAGCTTTTCTGTGACTGG - Intergenic
919166497 1:193901609-193901631 TTACACTGGTTGTAAATAACCGG + Intergenic
919675169 1:200374970-200374992 TTACACAGCTGGTTTGTGACAGG + Intergenic
920371142 1:205480153-205480175 ACACACAGCTAGAAAGTAACAGG + Intergenic
920979365 1:210818468-210818490 TCACACAGCAAGTAAGTAGCAGG - Intronic
922018604 1:221679083-221679105 TTAGAAAGCTTGAAAGTAAAAGG - Intergenic
922154791 1:223032327-223032349 TCACACAGCTTGTAAGTGGACGG - Intergenic
923402321 1:233627269-233627291 AGCCACAGCTTGTAAATAACAGG + Intronic
1063654375 10:7973050-7973072 TTACAAAGTTAGTAAGTAAATGG - Intronic
1064546761 10:16457944-16457966 TTATACAGCATGTAGGTAAATGG - Intronic
1065111825 10:22447938-22447960 TCACACAGCTTGTAAGCAGGGGG + Intronic
1065206916 10:23365738-23365760 TTGCATAGCTGGTAAGTCACGGG - Intergenic
1065304990 10:24360001-24360023 ATACACAGTCTGTCAGTAACTGG - Intronic
1066484380 10:35829262-35829284 TACCACAGCTGGTAAGCAACAGG + Intergenic
1067461700 10:46463007-46463029 TCACACAGCTAATTAGTAACAGG + Intronic
1067625494 10:47921594-47921616 TCACACAGCTAATTAGTAACAGG - Intergenic
1067938910 10:50635853-50635875 TTACACAGTTAATAAGTAGCAGG - Intergenic
1068100218 10:52543222-52543244 CTACACAGCTTCTCAGGAACAGG + Intergenic
1068263796 10:54620855-54620877 ATACACAGCTTTTCAGTAAAGGG - Intronic
1068340588 10:55696911-55696933 TTACTTGGCTTGTAAGTTACTGG + Intergenic
1068616164 10:59119995-59120017 TTTCTCAGTTTGTAAGTAATTGG - Intergenic
1069225484 10:65938836-65938858 TAACACAGCTGTCAAGTAACTGG + Intronic
1070424232 10:76269846-76269868 TTACATAGCTAGTAAGCAACAGG + Intronic
1070555981 10:77528004-77528026 TCACACAGCTTGTGAGTAGAGGG - Intronic
1070665988 10:78343826-78343848 TCACACAGCATGTAGGTAGCAGG - Intergenic
1071910261 10:90223815-90223837 TCACATAGCTTATACGTAACAGG - Intergenic
1072043993 10:91636719-91636741 TCACACAGCTAGTAGGTGACAGG + Intergenic
1072314610 10:94189895-94189917 ATACACTGCTAATAAGTAACAGG - Intronic
1072460785 10:95616839-95616861 TCACACAGCTTATAAATAACAGG + Intronic
1073038203 10:100579024-100579046 CAACACAGCTAGTAAGTAAGTGG - Intergenic
1073206421 10:101771696-101771718 TTGCACAGCATGTTAGTAGCTGG - Intronic
1076050261 10:127327839-127327861 TTGCACAGCCTATAAGTGACAGG + Intronic
1076303605 10:129447313-129447335 TTACAGAGCTTGTATTTAAGTGG + Intergenic
1077511895 11:2970479-2970501 TTATCCAGCTTGTAAGGAAGTGG + Intronic
1078359377 11:10656734-10656756 TCACACAGCTAGTAAGTAGCTGG + Intronic
1078912249 11:15743702-15743724 TTACACAGCTAGCAAGTGGCAGG - Intergenic
1079021940 11:16916431-16916453 GCACACAGCTTGTAAGTAGTGGG - Intronic
1079084073 11:17432900-17432922 TTACACAGCTTATAAGTAGCAGG - Intronic
1079567660 11:21902577-21902599 TCACACAGTTAGTAAGTGACTGG + Intergenic
1080162700 11:29197308-29197330 GTACACAGCTGGTAAGAGACAGG - Intergenic
1080563332 11:33484508-33484530 TTACACAGGAATTAAGTAACTGG - Intergenic
1081096098 11:38937323-38937345 TTACACAGCTGGTAAATGATAGG - Intergenic
1081113792 11:39172302-39172324 TTACACAGCTGGTAAGTAAAGGG + Intergenic
1081179967 11:39972973-39972995 TCACACAGTTAGTAAGTAGCAGG - Intergenic
1082068008 11:47916482-47916504 TCACACAGCTGGGAAGTAGCTGG + Intergenic
1083316543 11:61817979-61818001 TCACACAGCTTGTAAGTGGAGGG + Intronic
1083975976 11:66120648-66120670 ATACACAGCTAGTAAGTAAATGG - Intronic
1084034877 11:66503489-66503511 TTACACTGCCTGTAAGTGACAGG + Intronic
1085336363 11:75699780-75699802 TTACCAAGCTGGTAAGAAACAGG - Intergenic
1086205855 11:84257570-84257592 TCACACAGCTGGTAAATAGCTGG + Intronic
1087205582 11:95390503-95390525 TTACACAGCTATTAAGTAACAGG + Intergenic
1087234870 11:95706703-95706725 TCAAACAGCTTGTAAGTAACAGG + Intergenic
1087340060 11:96893032-96893054 ATAAACAGCTTGTAAATAAAAGG + Intergenic
1088094362 11:106081022-106081044 TCACACAGCTTTTAAGTATCAGG - Intronic
1089760845 11:120722044-120722066 TTACACAGCTAGTCAGTGTCTGG + Intronic
1089904588 11:122025445-122025467 TCACACAGCTTGTGAGTAGCAGG - Intergenic
1090732639 11:129585138-129585160 TCACACTGCTCGTAAGTGACAGG - Intergenic
1091842747 12:3632432-3632454 TCACACAGCTTGTCAGTGGCGGG + Intronic
1094005649 12:25747480-25747502 TTACATAGCTAGTAACTAATGGG + Intergenic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1095959154 12:47823109-47823131 TTGCACAACTAGTAAGTGACAGG + Intronic
1096680308 12:53251614-53251636 CCACACAGCTGGTAAGTGACAGG + Exonic
1098159415 12:67634890-67634912 TTAAATAACTTGTTAGTAACTGG - Intergenic
1098873030 12:75837642-75837664 TTACATAGCTCGTTAGCAACAGG + Intergenic
1099088202 12:78273558-78273580 ATACAGAGATTGTATGTAACTGG - Intergenic
1099838754 12:87939591-87939613 TCACACAGCTAGTAAGTTAAAGG - Intergenic
1100550459 12:95642135-95642157 TCACACAACTGGTAAGTGACAGG + Intergenic
1101448296 12:104754109-104754131 TTTCCCAGCTTGGAAATAACTGG - Intronic
1101593361 12:106141456-106141478 TTACACAGTTTGTAAATGGCAGG + Intergenic
1101791560 12:107932408-107932430 TTACTCAGCTAGTAGGTAAGAGG - Intergenic
1103026604 12:117579310-117579332 TCACACAGCTCGAAAGAAACAGG - Intronic
1103213545 12:119184146-119184168 TCACACAGCTTGGAAGTGACTGG - Intronic
1103848917 12:123918443-123918465 TAACACTGCTTGTAAGTCTCCGG - Intronic
1103882080 12:124173864-124173886 TCACCCAGCTAGTAAGGAACGGG - Intronic
1103892665 12:124251557-124251579 TCACACAGTTTGAAAGTAGCAGG - Intronic
1105576658 13:21659562-21659584 TCACACAGCTAGGAAGTAATGGG - Intergenic
1105609665 13:21956943-21956965 TTACACAGCTAATAAGTAACAGG - Intergenic
1106518920 13:30479642-30479664 TGACACAGCTAGTAAGCACCAGG - Intronic
1108993141 13:56689688-56689710 TTACACAACATGGATGTAACTGG + Intergenic
1109231281 13:59760461-59760483 TTACACAGATTTTGAGTTACTGG + Intronic
1109391135 13:61695189-61695211 AGACACAGCTAGTAAGTGACAGG + Intergenic
1110301414 13:73933031-73933053 TCACACAACAAGTAAGTAACAGG - Intronic
1110580322 13:77114422-77114444 TTAGAGAGCTAGTAAGTAGCTGG + Intronic
1112599998 13:100845888-100845910 TCACACAGCTAATAAGTGACGGG + Intergenic
1114453558 14:22841593-22841615 TTTTACGGCTTGCAAGTAACAGG + Exonic
1115092606 14:29596419-29596441 ATACAAAGCTAGTAAGTAGCAGG - Intronic
1115237450 14:31221486-31221508 TTACACATCTGGTAAATGACAGG + Intergenic
1115449161 14:33526543-33526565 TTAAACAGCTTGTTAGTCATGGG + Intronic
1117343795 14:54813584-54813606 TTATACAGCTGGTAAGTGCCAGG + Intergenic
1117958316 14:61139550-61139572 TCACACAGCTTGTAAGTGTCAGG + Intergenic
1120805079 14:88738310-88738332 TCACACAACTTGTAGGTGACTGG + Intronic
1122260427 14:100516726-100516748 ATACATAGCTTATAAGTAAAAGG - Intronic
1122895745 14:104756009-104756031 TTAAACAGCTTCTAAGTACTGGG + Intronic
1124794995 15:32769455-32769477 TTACACAGCTTGTCTGTGACTGG - Exonic
1125478549 15:40063993-40064015 CTCCACAGCTTGTAAGTGGCAGG + Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127973129 15:63977802-63977824 TCACACAGCTAGTAAGTGGCAGG + Intronic
1128344297 15:66843753-66843775 TCACACAGCTAGTGAGTACCAGG - Intergenic
1128383386 15:67130003-67130025 TTACACAGCTAGTGAGGAGCCGG + Intronic
1128393686 15:67201512-67201534 TTACACAGCATGAAAGAAACAGG - Exonic
1128436945 15:67662044-67662066 TTCCACAGTTTGGAAATAACTGG - Intronic
1131218842 15:90563730-90563752 TTACTCAGCTAGTAAGTGGCTGG + Intronic
1132040321 15:98520012-98520034 TCACACAGCTAGTAAGTTAGTGG + Intergenic
1132918177 16:2366126-2366148 TTACACAGCTGGTGAGTTGCAGG - Intergenic
1134088912 16:11379489-11379511 TTACACAGGTTGAAAGTGAAAGG - Intronic
1134300100 16:12983275-12983297 TCACACAGCTTGAAAGTGGCAGG - Intronic
1134429130 16:14184870-14184892 TCACAAAGCTTCTAAGTAGCAGG - Intronic
1134510035 16:14838863-14838885 TTAAGCTGCTTGCAAGTAACGGG - Intronic
1134666878 16:16025109-16025131 TTGCACAGTTGGTAAGCAACAGG + Intronic
1134697681 16:16237357-16237379 TTAAGCTGCTTGCAAGTAACGGG - Intronic
1134974160 16:18557313-18557335 TTAAGCTGCTTGCAAGTAACGGG + Intronic
1135046539 16:19160583-19160605 TCACACAGCTAGTAAGTGGCAGG + Intronic
1136027730 16:27480749-27480771 TCACAGTGCTTGTAAGTACCAGG - Intronic
1137711553 16:50570510-50570532 TCACACAGCTAGTAAGTGGCAGG - Intronic
1138317134 16:56080025-56080047 TTACACAGCTGGTAAGTATTTGG + Intergenic
1138867274 16:60837215-60837237 TTAAAGAGCTAGTAAGGAACAGG + Intergenic
1139156203 16:64445772-64445794 TCACACAGCTAGTAAGCCACAGG + Intergenic
1140007221 16:71090300-71090322 TTACAGAGCTAGTAAGTCAATGG - Intronic
1140232410 16:73128463-73128485 TCACACAGCTTATAAATGACAGG + Intronic
1140966723 16:79973582-79973604 TTACACATCTATTAAGTAGCAGG + Intergenic
1141353192 16:83317898-83317920 TCACCCAGCTTTTAAGCAACAGG + Intronic
1141564112 16:84889916-84889938 TCACAAAGCTGGTAAGAAACAGG - Intronic
1141696035 16:85619862-85619884 TCACACAGCTGGTAATTAATTGG + Intronic
1143436573 17:6932502-6932524 TTACACAGCTGGAAGGTAAAAGG - Intronic
1143529996 17:7497150-7497172 TCATACAGCTAGTAAGTAGCAGG - Intronic
1147332829 17:39708975-39708997 TTACACAGCTAGTGAGTGATGGG + Intronic
1147406820 17:40218474-40218496 GCACACAGCTTGTAAGTAATGGG + Intergenic
1147497183 17:40927897-40927919 TCACACAGCTAGTAAGTAACTGG - Intronic
1147568122 17:41550053-41550075 TCACATAGCTTTTAAGTGACAGG - Intergenic
1148105990 17:45119188-45119210 TCACACAGCTGGTAAATTACAGG + Intronic
1149338885 17:55666175-55666197 TGACACAACTTGAAAGTATCCGG - Intergenic
1150242031 17:63642171-63642193 TTACACTGCTTTTTAGTCACAGG + Intronic
1151128353 17:71869589-71869611 TCACACAGCTGGTAAGTAGCAGG + Intergenic
1152282336 17:79392318-79392340 TCACACAGCTAGTAAGTGGCAGG - Intronic
1156218644 18:35028351-35028373 TTACACAACTTGTAAGCACTTGG + Intronic
1156586112 18:38433142-38433164 TCACACAGCTAGCAAGTAGCAGG + Intergenic
1157504944 18:48219519-48219541 TCACACAGCCTGTAAATAGCGGG + Intronic
1157790960 18:50530505-50530527 TTCCCCAGCTTCTAAGTGACAGG - Intergenic
1158674196 18:59503421-59503443 TCACACAACCTGTAAGTGACAGG + Intronic
1159721893 18:71900250-71900272 TGACACAGTTTTTAAGTGACAGG + Intergenic
1160352452 18:78195256-78195278 TCACACAGCTTGGAAGTGATGGG - Intergenic
1161439378 19:4281841-4281863 ACACACAGCTGGTAAGTAAGAGG - Intronic
1162311494 19:9910276-9910298 TCACACAGCTAGTAAATTACAGG + Intronic
1164414671 19:28036836-28036858 TTACACAGTTTGTTTGTACCTGG - Intergenic
1165929703 19:39349052-39349074 TTACACAGGTAGTAAGTGGCAGG + Intronic
1166953619 19:46447238-46447260 TCACACAGCTGGTAAGAAGCAGG + Intergenic
1167018547 19:46857761-46857783 TTACACAGCTAGTAAGCAGCAGG - Intergenic
1167197886 19:48043310-48043332 TTACACAGTTAGTAAGTGGCAGG - Intronic
1167403277 19:49287117-49287139 TGAAACAGCTTGTTAGTAACTGG + Intergenic
926637869 2:15202985-15203007 TCACACAGCTATTAAGTGACAGG - Intronic
928920484 2:36521780-36521802 TTACAATGCATGTAAGTAAATGG - Intronic
929019014 2:37531870-37531892 TCACAGAGCTATTAAGTAACAGG + Intergenic
930445126 2:51461089-51461111 TTACACAGCTAGTAAGCAGCAGG + Intergenic
930548560 2:52801427-52801449 TTACACAGCATATAAGTAGTGGG + Intergenic
931920847 2:67014022-67014044 TTACACAGTTGGTAAGATACGGG + Intergenic
932901534 2:75706332-75706354 TCAGACAGCTTATAAGTAGCAGG - Intronic
933773990 2:85760892-85760914 TCACACCGCTTGTAAGTGCCTGG + Intronic
934070012 2:88375117-88375139 TCACACAGTTTGTAAGAATCAGG + Intergenic
935289533 2:101598388-101598410 TTACACAGCTTGTCAGTTCTGGG + Intergenic
935688760 2:105711650-105711672 TTACACAGCTGGTAATTGGCAGG + Intergenic
937027192 2:118709284-118709306 TCACACAGCTAATACGTAACAGG - Intergenic
937273270 2:120668853-120668875 TCCCACAGCTTCTAAGTGACAGG - Intergenic
937470281 2:122168544-122168566 TCACCCAGCTGGTAAGTAGCAGG - Intergenic
937786689 2:125907129-125907151 TTACACAGCTTCTAAGGGTCAGG - Intergenic
938785959 2:134630126-134630148 TCACACAGCTGGTAAGTGACAGG - Intronic
940051490 2:149469783-149469805 TCACACAGCTGGTAAGTGACAGG + Intronic
940533919 2:154914252-154914274 TTGCACTGCTTGTGAATAACAGG + Intergenic
941101700 2:161303624-161303646 TGACACAGGTTGAAAGTAAAAGG - Intergenic
941242278 2:163054369-163054391 CTACATTGCTTGTAAGGAACTGG - Intergenic
941466583 2:165835235-165835257 TTACAAAGCTAGTAAGTGATAGG - Intergenic
941951129 2:171159416-171159438 TTACACAGCTTGTAAGGCACCGG - Intronic
942386135 2:175445106-175445128 TCACACAGCTGGTAAGTGGCAGG - Intergenic
942505920 2:176641644-176641666 TCACACAGCTAGTAAATGACAGG + Intergenic
945213443 2:207408256-207408278 TTACACAGGGGCTAAGTAACTGG - Intergenic
945357365 2:208856451-208856473 TTCCCCAGCTTGTAAGCAAGAGG + Intergenic
945484000 2:210372888-210372910 TTACACAGTTTCTATGTATCAGG + Intergenic
945694380 2:213084190-213084212 ATATACAGCTGGTAAGTGACAGG - Intronic
946281524 2:218669258-218669280 TTGCATAGCTTGTAAGTGATTGG - Intronic
947990367 2:234482827-234482849 TCACACAGCTAATAAGTGACAGG + Intergenic
948328150 2:237142870-237142892 TCACACAGCTGGTAAGTGGCTGG - Intergenic
1169200038 20:3704527-3704549 TTACCCAGTTTGTAAGCAAGAGG + Intronic
1169539702 20:6585841-6585863 TCACACAGCTTCTAAGTAGTAGG - Intergenic
1170538028 20:17361192-17361214 TAAAACAGCTTTTCAGTAACAGG + Intronic
1171467586 20:25341492-25341514 TTGCACAGCTAGTAAGTGATGGG - Intronic
1172306997 20:33887883-33887905 TCACACAGCTAGTAATTATCAGG - Intergenic
1172356667 20:34285141-34285163 TTACACAGCCTGTAAGTGGTGGG + Intronic
1173152070 20:40575916-40575938 TCATACAGCTAGTAAGTAAGTGG + Intergenic
1173200335 20:40950041-40950063 TCACACAGCTGGTAAATAGCTGG - Intergenic
1174632859 20:51973341-51973363 ATACACAGCTAATAAGTAGCAGG + Intergenic
1175348675 20:58302159-58302181 TAACACAGCTAGTAAGTGACGGG - Intergenic
1177185463 21:17788761-17788783 ATACACATCTAGTAAGTCACAGG + Intergenic
1178784355 21:35638822-35638844 TCACACAGCTGGAAAGTAGCTGG - Intronic
1182560471 22:31155114-31155136 CTACACAGCTGGTAAGAATCAGG - Intergenic
1183856002 22:40635831-40635853 TTACACAGCTAGCAAGTGGCAGG + Intronic
1184867142 22:47207973-47207995 TTGCACAGCTGGTAAGTAGTGGG + Intergenic
949437143 3:4041706-4041728 TAACACATCTTGTAAGGCACAGG + Intronic
950223322 3:11213326-11213348 TCACACAGCTAGTAAGGAACAGG - Intronic
950295911 3:11830399-11830421 TCACATAGCTAGTAAGTACCTGG - Intronic
950354468 3:12394298-12394320 ATGCACTGCCTGTAAGTAACAGG - Intronic
950617266 3:14171203-14171225 TTACACAAGTTAAAAGTAACTGG - Intronic
952234836 3:31468495-31468517 TTTCATAGCTTTTAAGGAACAGG - Intergenic
952751219 3:36826465-36826487 TTACACAGCTCGTTAGGAACAGG + Intergenic
952874772 3:37935528-37935550 TCACATAGCTTCTAAGTAGCAGG - Intronic
953129588 3:40125172-40125194 TTACAGAGCTAGTAAGTGGCAGG - Intronic
953457582 3:43055118-43055140 TCACACAGCTAGTAAGTAGCTGG - Intronic
955144837 3:56306803-56306825 TCACACAGCTTGAAAGTGATAGG - Intronic
955842865 3:63130529-63130551 TCACACAGCTTGTAAGTGTTGGG - Intergenic
956075832 3:65504466-65504488 TTACACAGCTGGTAAGTGTCAGG + Intronic
956747204 3:72319495-72319517 TGACACAGCTAGTAAGTAGCAGG - Intergenic
956828952 3:73026907-73026929 TTGCACAGGTAATAAGTAACAGG - Intronic
957174105 3:76782743-76782765 ATACACAGCCTGAAAGTAAGTGG - Intronic
957954789 3:87172341-87172363 CTACATAGTTTGTAAGTAATTGG - Intergenic
959187712 3:103067893-103067915 TTACACAGCTTCTAAGTTATTGG - Intergenic
959566486 3:107837820-107837842 TTAAACAGCTTGTGTCTAACAGG - Intergenic
959827142 3:110811728-110811750 TTACACAGTTTGTAATTAATAGG + Intergenic
959925106 3:111912249-111912271 TTATACAGTTTGTGAGCAACAGG - Intronic
960190905 3:114705081-114705103 CTACACAGCTAGTAAGGAAAAGG + Intronic
961937154 3:130597382-130597404 TTACAGAGCTTATAAGTTAATGG - Intronic
962652418 3:137509848-137509870 TAAGACAGCTTGTAAGTAACTGG - Intergenic
962722590 3:138189545-138189567 ATACAGAGCTTGTACGTAACTGG - Intronic
962909360 3:139833854-139833876 TCACACAGATAATAAGTAACAGG - Intergenic
963052431 3:141153467-141153489 CTGCATAGCTTGTAAATAACCGG + Intergenic
963485143 3:145926374-145926396 TCACACAGCTAATAAGCAACAGG - Intergenic
963738075 3:149044076-149044098 TCACACAGCTAGTGAGTGACAGG - Intronic
964648499 3:158985507-158985529 TCACACAGCTAGTATGTAATTGG - Intronic
964871441 3:161317846-161317868 TCTCACAGCTAGTAAGTAGCAGG + Intergenic
964872689 3:161330550-161330572 TTACACAGCTAGTAAGTGGTAGG - Intergenic
964939936 3:162146050-162146072 CCACACAGCTAGTAAGTAGCAGG - Intergenic
965430802 3:168585797-168585819 TTATCCAGCTGGTAAGCAACAGG - Intergenic
966433784 3:179860833-179860855 TTATACAGCTAGTAAGTGGCAGG + Intronic
966443853 3:179978130-179978152 TTATCCAGCTAGTTAGTAACTGG - Intronic
968535431 4:1124737-1124759 TTACACAGCATTTAAGTACTAGG - Intergenic
969347354 4:6577610-6577632 TCACACAGCTTGTAAGCGGCAGG + Intronic
969923785 4:10565875-10565897 TCACACAGCTAGTAAGTCATGGG + Intronic
970656538 4:18236622-18236644 TTACATAGCTAATAAGTAATAGG - Intergenic
971338609 4:25747007-25747029 TTACTGAGCTTGTCAGTTACAGG + Intergenic
972428520 4:38958228-38958250 TCACACAGCTTTTAAGTGGCAGG - Intergenic
972573606 4:40332141-40332163 TTACACAGCTAGTAAGTGGTGGG + Intergenic
972977020 4:44648100-44648122 TTACACATCTAGTAAGAAATGGG - Intronic
973254278 4:48093237-48093259 TTACACTGGTTCTAAGTATCAGG - Intronic
973743660 4:53942730-53942752 TTCCACAGCTAGTAAGTTGCAGG + Intronic
974104015 4:57447139-57447161 TCACAGAGCTTGCAAGTAAATGG + Intergenic
974575315 4:63712043-63712065 TTGCACAGCTAGTAATTATCAGG - Intergenic
974913582 4:68151979-68152001 TCACACAGCTTGTAAGGAGTAGG + Intergenic
975238105 4:72024802-72024824 TCACACAGCTAGTAAGTGACAGG - Intergenic
976027795 4:80711619-80711641 GTACATAGCTTGTGAGTAGCAGG + Intronic
977293000 4:95183260-95183282 TCACACAGCAAGTAAGTAGCAGG + Intronic
977937412 4:102823010-102823032 TCACACAACTAGTAAGTGACTGG - Intronic
979526423 4:121722178-121722200 TTACACAGCTGGTAAGTGACAGG - Intergenic
987017922 5:13838875-13838897 TAACACAACTTGTAAATAGCAGG + Intronic
988782647 5:34537345-34537367 TTACACAGCTTTTAAATAAAGGG + Intergenic
989341160 5:40377327-40377349 TTTCATAGCTAGTAAGTAACTGG + Intergenic
989362948 5:40624240-40624262 TTACACAGCTTTTATGTAGCAGG - Intergenic
990548692 5:56850672-56850694 TAACACAGTTTGTAAGTGAGTGG - Intronic
990958731 5:61370249-61370271 TTATACAGCTTTTAAATAATGGG - Intronic
992618341 5:78567870-78567892 GCACACAGCTAGTCAGTAACAGG + Intronic
992848361 5:80778030-80778052 TCACATAGCTAGTAAGTAAGTGG + Intronic
993397601 5:87410031-87410053 TCACACAGCTAATAAGGAACAGG + Intronic
995594393 5:113732185-113732207 TCACACAGCCTGTAAGTAAGTGG - Intergenic
997456173 5:134019113-134019135 TCACACATTTTATAAGTAACTGG - Intergenic
998564595 5:143205691-143205713 ATACCCAGCCTATAAGTAACAGG - Intronic
998880904 5:146643718-146643740 TTCCACAGGTTTTAAGGAACAGG - Intronic
999012446 5:148057510-148057532 TTACACAGTTTGCATGTGACTGG + Intronic
999217880 5:149950793-149950815 TTACACAGTTAGCAAATAACAGG - Intergenic
999626122 5:153522154-153522176 TTACACAGCTAGAAAGTAGTGGG - Intronic
999850440 5:155532115-155532137 TTACACAGCTAGTAAGTTTCAGG - Intergenic
1000022997 5:157335124-157335146 TCACACAGCTAGTAAGTAGCAGG - Intronic
1000744105 5:165009386-165009408 TTACACAGCGTGCAGCTAACTGG - Intergenic
1001095701 5:168773898-168773920 TCACACAGCTAGTAAGGAGCAGG - Intronic
1001222790 5:169916857-169916879 TCACATAGCTAGTAAGTAATGGG + Intronic
1006728328 6:36216100-36216122 TTACACAGCTAGTAAGAAATTGG - Intronic
1007308237 6:40923750-40923772 TTACACAGCTTAGAAGTAGCAGG + Intergenic
1007423258 6:41732316-41732338 TCACACAGCCTGGAAGTGACAGG - Intronic
1007475535 6:42117361-42117383 TCACACAGCTAGTAAGTGCCAGG + Intronic
1007862522 6:44928110-44928132 CTACTCAGCTTGTAGGTAGCAGG + Intronic
1008290852 6:49713968-49713990 TTACACAGGTTGTCAGTTTCAGG + Intergenic
1010091569 6:71988950-71988972 TTAAACAACTTGTAAGGAAAAGG + Intronic
1011029476 6:82906212-82906234 TTACACTGCTTTTAATTAATAGG + Intronic
1012650821 6:101750251-101750273 TTACACAGAAGGTAAGTGACAGG + Intronic
1013633444 6:112007066-112007088 TCCCACAGCTAGTAAGTGACAGG - Intergenic
1019048342 6:169164757-169164779 TTCCATAGCTTGTGAGGAACTGG - Intergenic
1019806442 7:3129815-3129837 TTACGCAGCTGGAAAGTAGCGGG + Intergenic
1020841089 7:13218849-13218871 TTACAAGGCTGGTAAGTAGCAGG + Intergenic
1021260052 7:18444445-18444467 TTACATATCTTGTAAATAAAAGG + Intronic
1021986697 7:26104271-26104293 TTACACACCATGTAAGTGACAGG + Intergenic
1022752333 7:33242925-33242947 ACACACAGCTGGTAAGTAGCAGG - Intronic
1022772997 7:33494510-33494532 TACCACAGGTTGTAAATAACTGG - Intronic
1025078246 7:55962099-55962121 TTACTCAGCCTGTGAGGAACTGG - Intronic
1025613895 7:63101697-63101719 TTATACAGCTGGTAAGTGGCAGG - Intergenic
1026891828 7:73986702-73986724 TTACACAGCCTGTCAGTGTCAGG - Intergenic
1026925447 7:74189125-74189147 GGACACAGGTTGTCAGTAACAGG + Intronic
1026964667 7:74431467-74431489 TGGCACAGCTTATAAGTAGCAGG + Intergenic
1027758844 7:82251794-82251816 TTACATAGCTTGGAAGGAGCAGG + Intronic
1027915090 7:84307719-84307741 TGACACTGTTAGTAAGTAACCGG + Intronic
1030743174 7:113134061-113134083 TTAAACAGTTTGTAAGTAAGTGG - Intergenic
1031965337 7:128023977-128023999 TCACACAGCTAGTAAGTGATGGG + Intronic
1032218402 7:129975184-129975206 TTACTGATCTTGTAAGTAGCTGG - Intergenic
1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG + Intronic
1032746218 7:134789275-134789297 TCCCACAGCTAGTAAGTAGCTGG + Intronic
1033879085 7:145859421-145859443 TTACACACCTAGTAAGTAATGGG - Intergenic
1034311974 7:150096699-150096721 GTACACAGACTGTAAGTAAAGGG - Intergenic
1034794885 7:154003959-154003981 GTACACAGACTGTAAGTAAAGGG + Intronic
1035544175 8:466789-466811 CCACACAGTCTGTAAGTAACTGG + Intronic
1037440526 8:18911449-18911471 TTACACAGCAAGGAAGTCACGGG - Intronic
1037484184 8:19331848-19331870 TCACATAGCTCGTAAGTGACAGG + Intronic
1039200088 8:35081678-35081700 TTACATAGCATGTATGTAATAGG - Intergenic
1040624506 8:49131558-49131580 TTACACAGCTTTTATGTTAATGG - Intergenic
1042016232 8:64316191-64316213 TTATACAGTTTGAAAGTAAGTGG - Intergenic
1042596429 8:70452872-70452894 TTACAAAGATTGCAAGGAACTGG + Intergenic
1042737601 8:72005813-72005835 TCACACAGCCCGTAAGTGACAGG - Intronic
1042829103 8:73007645-73007667 TCACACAGCTAGTGAGTAACTGG + Intergenic
1044717400 8:95113121-95113143 TCACACAGGTTGTAAGCAAGTGG + Intronic
1046652905 8:116858771-116858793 TTACACCGCCTGTAAGTTGCAGG - Intronic
1046702503 8:117417590-117417612 TTAGGGAGCTTGTAATTAACTGG - Intergenic
1047190550 8:122675236-122675258 ATACACATTGTGTAAGTAACTGG + Intergenic
1047374041 8:124279226-124279248 TCACACAGCTGGTAACCAACAGG - Intergenic
1047862792 8:128987354-128987376 TGACACAGCTTGTAAGTGCTGGG + Intergenic
1047925619 8:129679699-129679721 TTACATAGCTAGGAAGTGACAGG - Intergenic
1048863337 8:138740163-138740185 TTATTCATCTTGTAAATAACCGG - Intronic
1049028600 8:140015242-140015264 TCACACAGCTTGCAGGTGACAGG - Intronic
1049410022 8:142469030-142469052 CCACACAGCTTGTAAGTGGCAGG + Intronic
1050515838 9:6443408-6443430 TTAGAGAGCTAGTAAGTAGCAGG + Intronic
1052255720 9:26454169-26454191 TTACACAGCTGGTAAGTGGCAGG - Intergenic
1052558163 9:30047646-30047668 TTACAGTGTTTGTAAATAACTGG - Intergenic
1053015484 9:34659713-34659735 TTACCCAGCTTGTAAGTGCAGGG - Intronic
1055003821 9:71483469-71483491 TTATACAGCGTGTCAGCAACAGG + Intergenic
1055554558 9:77461487-77461509 TCACACAGCTTGTAAGCAATTGG + Intronic
1056457368 9:86773614-86773636 TCACACAGCTGGTAAGTGTCAGG + Intergenic
1057299706 9:93870761-93870783 TGACACAGCTGGCAGGTAACAGG + Intergenic
1058166369 9:101623885-101623907 TTACACAGCTAGTAAGTGTTGGG + Intronic
1058411922 9:104742624-104742646 TTACCCAGCTAGTAGGTACCTGG + Intergenic
1058783808 9:108365802-108365824 TTACACAGCTAGAAAGTGGCTGG - Intergenic
1058913338 9:109541398-109541420 TCACACAGCTGGTAAGTGACAGG + Intergenic
1059183571 9:112243910-112243932 TTACACAGCTCATAAATAATAGG + Intronic
1059252754 9:112901747-112901769 TCACACAGCTAGTAAGCATCAGG - Intergenic
1060126010 9:121047223-121047245 TTATACGGTTTGTAAGTAAATGG + Intronic
1060153840 9:121305500-121305522 TCACACAGCTAGTAAGTGATTGG + Intronic
1060291828 9:122310198-122310220 TCACTCAGCTTGTAAGTGGCAGG + Intronic
1060472480 9:123959882-123959904 TCACACAGCTGGAAAGAAACTGG + Intergenic
1060533920 9:124367640-124367662 TCACACCGCTGGTAAGTAACAGG - Intronic
1060680837 9:125562834-125562856 TTAAACAGCATGTAAGTGACAGG + Intronic
1060840569 9:126789974-126789996 TCACACAGCTGGTAAGTGATGGG - Intergenic
1061538977 9:131267117-131267139 TCACACAACTGGGAAGTAACTGG + Intronic
1062218427 9:135401654-135401676 TCACACAGCCTGTAAGTGGCAGG + Intergenic
1186508786 X:10115304-10115326 CCACACAGCTTGTGAGTGACTGG + Intronic
1186903686 X:14087576-14087598 TTACACAGCTAACAAGTGACAGG - Intergenic
1187734196 X:22288257-22288279 TTACATAGCTAATAAGTAGCAGG + Intergenic
1188247912 X:27856546-27856568 TCACACAGCTAGTAAGTGACAGG + Intergenic
1188429539 X:30090639-30090661 ATACACAGATAATAAGTAACAGG - Intergenic
1188444826 X:30245482-30245504 TCACACAGCTAGTAAGTGATAGG + Intronic
1188989555 X:36801045-36801067 CTACACACCTTTTAAATAACCGG - Intergenic
1190478578 X:50851953-50851975 TGACACAGCTAGTAAGTAGCAGG - Intergenic
1191934720 X:66414193-66414215 TCACACAGCTAGTAAGTTTCAGG - Intergenic
1192054968 X:67764196-67764218 TCACAAAGCTGGTAAGTAGCAGG + Intergenic
1192587005 X:72327056-72327078 TCACACAGCTAGTAAGTGAAGGG + Intergenic
1193102650 X:77633110-77633132 TTGCACAGCTACTAAGTATCTGG - Intronic
1193513067 X:82430198-82430220 ATTGACAGCTTGTCAGTAACTGG - Intergenic
1194340950 X:92704880-92704902 TAACCCAGCTAGTAAGTGACAGG - Intergenic
1194995758 X:100589838-100589860 TCACACAGCTTGTAAGTGGTGGG + Intronic
1196650714 X:118165742-118165764 TCACACAGCTGGGAAGTAAGTGG - Intergenic
1196786316 X:119424403-119424425 TCACATAGCTAGTAAGTAAGTGG + Intronic
1197829698 X:130628281-130628303 TCACACAGCTGGTAAGTGGCAGG + Intronic
1199165681 X:144672523-144672545 TTACACAGCTAGTTAGTGTCAGG + Intergenic
1199769945 X:150968910-150968932 TCACATAGCTGGTAAGTGACAGG + Intergenic
1200649304 Y:5821599-5821621 TAACCCAGCTAGTAAGTGACAGG - Intergenic
1202273030 Y:23088614-23088636 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202292996 Y:23332068-23332090 TTACACAGCTTGGAAATGAGAGG + Intergenic
1202426027 Y:24722358-24722380 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202444762 Y:24947728-24947750 TTACACAGCTTGGAAATGAGAGG + Intergenic