ID: 1032636306

View in Genome Browser
Species Human (GRCh38)
Location 7:133712939-133712961
Sequence TGTCCCCTTTCCCTAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032636306_1032636313 18 Left 1032636306 7:133712939-133712961 CCAGGGGCTAGGGAAAGGGGACA No data
Right 1032636313 7:133712980-133713002 CTGGATAAGGGCTCTTACTTTGG No data
1032636306_1032636310 -1 Left 1032636306 7:133712939-133712961 CCAGGGGCTAGGGAAAGGGGACA No data
Right 1032636310 7:133712961-133712983 AATTGGGAGGAAGTGCTTACTGG No data
1032636306_1032636311 5 Left 1032636306 7:133712939-133712961 CCAGGGGCTAGGGAAAGGGGACA No data
Right 1032636311 7:133712967-133712989 GAGGAAGTGCTTACTGGATAAGG No data
1032636306_1032636314 26 Left 1032636306 7:133712939-133712961 CCAGGGGCTAGGGAAAGGGGACA No data
Right 1032636314 7:133712988-133713010 GGGCTCTTACTTTGGAGTGACGG No data
1032636306_1032636312 6 Left 1032636306 7:133712939-133712961 CCAGGGGCTAGGGAAAGGGGACA No data
Right 1032636312 7:133712968-133712990 AGGAAGTGCTTACTGGATAAGGG 0: 1
1: 0
2: 4
3: 24
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032636306 Original CRISPR TGTCCCCTTTCCCTAGCCCC TGG (reversed) Intronic