ID: 1032637212

View in Genome Browser
Species Human (GRCh38)
Location 7:133722631-133722653
Sequence ATTTTAAAGGTCATTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032637207_1032637212 -8 Left 1032637207 7:133722616-133722638 CCTTGAATTTTAGGCATTTTAAA 0: 1
1: 0
2: 5
3: 59
4: 526
Right 1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032637212 Original CRISPR ATTTTAAAGGTCATTGGGGA AGG Intronic
No off target data available for this crispr