ID: 1032637212 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:133722631-133722653 |
Sequence | ATTTTAAAGGTCATTGGGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1032637207_1032637212 | -8 | Left | 1032637207 | 7:133722616-133722638 | CCTTGAATTTTAGGCATTTTAAA | 0: 1 1: 0 2: 5 3: 59 4: 526 |
||
Right | 1032637212 | 7:133722631-133722653 | ATTTTAAAGGTCATTGGGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1032637212 | Original CRISPR | ATTTTAAAGGTCATTGGGGA AGG | Intronic | ||
No off target data available for this crispr |